Gene detail

Detailed information of OS493_011727-T1 in Lophelia pertusa

Genomic Location: scaffold_30:716587...725016
NR annotation: KAJ7336517.1, NHL repeat-containing protein 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011727-T1

ATGGTGCTCACAGAAGGTTGGTTTATCAAACGGGCAGAGGAGCTGATAGCTGCCTTAAAATCTGCATCCTCAGATGAAGAGAAACACGAAGCCATTTCCACCTACATCCAATGGATGGAATCAAAAGATTCGACAAATATTCCAGAATTTGATTCGAATCTGGAGTGGCTAAACTGCACGAGTCCTTTATCTTTCAAAGACCAGCTTCGTGGGAAATTGTGCGTGTTGGATTTCTTTACATATTGCTGCATAAACTGCATGCATATTTTACCCGATCTGGAAGCATTGGAGCACCTTTACTCCGAGAAAGATGGTCTTGTTATACTCGGGGTTCACTCAGCAAAATTCGAGAACGAAAAATCGTCCACGAACATTTTGAGTGCCGTGTTACGGTATGATATCAGGCATCCCGTTGTAAATGATTCCGAGGCAAAGCTATGGCACACCTTGTCCGTTCAGTGTTGGCCAACTTTAGTTGTTGTGAGTCCAGAAGGAAACATTCTTCTTAGTCTGGTGGGGGAAGGGCACAGAGACACTCTTTTACAGTTTGTGGGATCAGCTTTGAAATTTTACAAACAGAAAGGGAAAGTGAAGGAGCATTCAATTGGTGTCTCTCTGGCCAAAGACACCCTACCCCTGACAAGTCTCTCATTTCCTGGGAAAATATCTACAGACAAGGGAGGGGAAAGATTTGTAGTGGCTGACACAGGGCATCATAGAATCCTTCTAATAAGCAAAGAAGGAATTATTTTGAATGCTATCGGTGGAGGTGAAAAATATGAAGCTGGATTTGTGGATGGGTCATTTCAAGAAGCAAGATTTCATTCACCCCAAGGAGTAGCTCTTGAAAAGGAAGTTATTTTTGTTGCTGATACAGAGAACCATGCAATCAGACAGATTAATCTAGAGAAAGGAACGGTCATCACTGTTGCTGGTAATGGTAAGCAAGGAAGTGACAAGGAAGGTGGAAACATAGGAACATCACAAAGCATCAGTTCACCATGGGATGTTACTGTTGGTCCTCCACCTGGACCTCAAAGTGCAGAGGATGCGAGTGTTAAAGATGTTCTGTACATTGCCATGGCAGGCACACATCAAATCTGGGCATTGTATTTAAAGGACAGCGCATGGTTTAAAGGAGGTTCCCAGGTGCAAGGCACTTGCCTTCGTTTTGCTGGTAGCGGTGCAGAAGAGAATCGCAACAACAGTTACCCACACAAGGCTTCCTTTGCACAACCCTCAGGCATCAGTCTTGCAATGGAAAAACCATTCAGGTACTTGTTTGTGGCAGACAGTGAAAGCAGCAGTGTGCGGACAGTTGATGTGGCCAGTGGTGGTACAAAGGCTCTTGTAGGAGCAGACAGGGATCCAACAAATCTGTTTGCATTTGGTGATCAGGATGGTAAAGGTATTGATGTTAAGCTGCAACATCCTTTGGGAGTGGCCTGGAATCCACATTCACAGAAGTTGTATGTGACAGACTCGTATAACCACAAGATTAAAGTTATCGACCCTTCAAAGAAGACCTGCGAAACATTTTTGGGCACTGGTAAACCAGGGCTATCTTCTGACGAAGGTAACATACAGTTTGACGAGCCAGGTGGTCTGTGTGTCAGTCCAGACGGACAGTTCTTATACGTGGCAGACACTAACAACCATGCCATTCGAGTCATTGACTTGAACACGAAATCTGTATCTCAGCTAAATATCGTGGAACTTTCTCAAATTTCGATGGACCGAGCGGACGGCCAATCAAACCAAAAGCGCGCTGTGGCAAAACGGCTAACTTCAAAAAGAACGCCAGTCACGTGCAAAGAACCAGTTCACGTGACCAGCGGGTCGTACCTTGAAGTGAGGCTGAACATTAGTCTCCCCTCGGGATGTTACTTGACAAAGGGTGTGGCCAGTGACTGGCAGGTCGTGATCTTTGAGCGACAAGAAGATAAAGAAGTTCTTCAGGAGCAGTTTAAGTTGGAGCCTCCATCTGGTGTTTTCACCGAAGATTCCCTTGGTGCTGTCTGCAAGATCCGGATGCCAGATGAAAACTGGGAACCACAAACTATTTCCCGGATCGAGGCAGTAATATATTTCTGTGAACCGAGCGGTACATGCAGAATGGAGGAGCTTGTGTACGAAGTACCATTGCTCAAAACAGACAGAGAGGGCGAGAGTTCGCTCCAAATAAACCATGAATGCAAGCTTTGA

Transcript

OS493_011727-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8BZW8	NHL repeat-containing protein 2 OS=Mus musculus OX=10090 GN=Nhlrc2 PE=1 SV=1
Q8NBF2	NHL repeat-containing protein 2 OS=Homo sapiens OX=9606 GN=NHLRC2 PE=1 SV=1
Q5ZI67	NHL repeat-containing protein 2 OS=Gallus gallus OX=9031 GN=NHLRC2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006177 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13905 all species →	Thioredoxin_8	Thioredoxin-like	Domain	Interproscan
PF01436 all species →	NHL	NHL repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001258 all species →	Repeat	NHL repeat	Interproscan
IPR012336 all species →	Domain	Thioredoxin-like fold	Interproscan
IPR036249 all species →	Homologous_superfamily	Thioredoxin-like superfamily	Interproscan
IPR013766 all species →	Domain	Thioredoxin domain	Interproscan
IPR011042 all species →	Homologous_superfamily	Six-bladed beta-propeller, TolB-like	Interproscan
IPR045302 all species →	Domain	NHL2, NHL repeat domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46388 all species →	NHL REPEAT-CONTAINING PROTEIN 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_011727-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011727-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

47.4Max TPM

12.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.70	9.65
polyp at pH7 6	18	18	8.12	12.97
coral polyp · control treatment	16	16	12.79	24.16
coral polyp · oil and dispersant treatment	16	16	29.86	47.44
coral polyp · oil treatment	16	16	12.54	20.95
coral polyp · dispersant treatment	16	16	9.87	33.64
Polyp	10	9	3.67	7.53

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.65
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.62
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.31
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.75
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.73
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.34
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.93
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.91
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.82
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.66
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.48
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.46
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.11
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.81
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.50
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.26
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.20
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.97
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.19
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.50
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.82
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.68
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.13
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.90
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.41
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.09
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.02
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.43
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.41
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.90
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.45
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.36
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.23
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.83
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.78
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.16
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.69
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.59
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.27
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.17
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.91
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.83
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.74
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.50
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.56
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.32
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.48
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.24
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.66
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.64
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.88
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.44
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.87
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.34
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.33
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.66
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.95
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.59
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.24
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.06
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.89
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.80
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.10
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.13
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.28
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.46
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.70
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.95
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.50
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.37
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.14
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.44
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.29
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.11
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.81
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.85
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.46
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.41
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.21
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.56
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.17
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.23
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.10
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.64
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.17
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.83
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.11
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.69
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.22
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.82
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.55
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.25
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.19
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.01
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.10
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.73
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.85
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.92
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.84
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.53
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.91
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.46
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.14
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.26
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.07
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.86
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.19
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.25
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.