Gene detail

Detailed information of OS493_011807-T1 in Lophelia pertusa

Genomic Location: scaffold_30:1881758...1894482
NR annotation: KAJ7336591.1, Fibroblast growth factor receptor 4 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011807-T1

ATGGAGGCGTTTAAGAAGCCGTTAGCGATGCTTCTTCTCATAATTGTATTCTCTTCGATAGCACATTCAGATCACGATCGACCGACGTTCAGAAATCCATCCAAAAACCGCGATCGTTTTCTGGAATACATTGAAGGTGTTCAGGTCAAGCTCAGGTGCCATGCAAAGGGAGTGCATCCACTCAATGTGACGTGGCTGAAGAACGGCAAGCCGTTGATTCGAGCTGGCCAGACGCTCTTGAAATCCAAAGGCTGGGTTTTAAATTTCGCCACATTATCTTATAACGATGCTGGCACCTACACTTGCACAGTGAGGAATGCATTTGGTATCATCAAGCGGACGTTTATTATCAAAGTTGTTGTTGATCCTCCTCAACCGCATCCTCAGGAACGCAAACCTATGATTTTGGAGAACGTTTTAAAGAACAAAACGGCCATAACTGGCGAAGACGTCACGTTTGTGTGCTCGGCCGTTAGCAAAAGTCATCCAGAGTTTCACTTTCTCAAGTGGAAATCACTCAAAAATGTTTCAAATGGCTCTGATCCTTTCGAGTTTGTTGACTTTACCAAATCCAAGTTCCGTGAGATTCGTAAGATTGACAAGCAGCACATGGGCAACCGTCAAGTCTACACACATCGACTCATTGTGAGAAACGTCACGTTGGCGGATGCGACCAAGTACACATGCGTGGTGGGGAGTTCCGCTGGTTATGTATCCAAGCACGCGTATCTTATCGTCCTGAGCCGGGAAGACAAATATCCACCGCGCATTCGAGGTACTCCAAAACTTCAGTATAACGCTGATGTAGGAGAACTCAAAAGATTACGATGTGGAGTGACGGGACTTCCACCACCGACCATTACATGGATCAAGGATGATAAGCCTTTACAGTTGACAGAAAGAGTAAGGAATTTGAACAACAACAACAAAACTATAAAGATCAAACAAGTCAGACTTGGTGACCAAGGAAACTACACCTGCATTTCTGAAAATCCTCACGGGAAACTTAGTTTGACTCTAGAACTCAATGTCCGTCAAGGAGCGCCAACCTTTTCTGATCCAAGTATAAAAAGAGCATTTAGAGCATGGCCATCATCACACTCGATCAGACTGGAGTGTTTAGCAACTGGAGCACCACCTCTCAAATACACATGGCTAAAAGACGGAAAGAAAATGCCAAGACGATGGATGGACCCATATCTTAACAGTTCAATATGGTATCTAAAACTGAAAGATCTGGTGCTCAACGATACTGGGAAATACACTTGCATAGTGTCCAATCCATATGGCAGTATAAATCACACTTACACGCTTCTGGTTGTTGCTAAAAAACCACTATCGCCGCCCATCCTACAAAATGACCTTCCAAAGAACACAACCGTGCAGCTTGGGGATAATGCAACAATGACATGCATTGTGCTTGTTAGTGGAACACTTCCTGACTTTAAATGGCTGAAGTGGGACAAATCCATCACATCGATCCAGAAAATTGGTGACGATTTGGACAAGGAATCATACCACCTTATAGACCCACATAATTACAACACTATCCAAGTTAAAGACAGTTATGGCGTTGAGTTGAGAATTACCAATGTGACAGAGGACGATCTTGGACTCTACACTTGCGTTGTGAGTAATCATGTCGGCAAGAATTACAACAGTGCATTCCTCAGCACATATGTGAAACCCACGATTCCTGTTAGAGGAGGGCCAACCTTTTCTGATCCAAGTATGCTAAAAAGAGCATTTAGAGCATGGCCAGCATTACACTCGATCAGACTGAAGTGTTTAGCCACTGGAGCACCACCTCTCAAATACACATGGCTAAAAGACGGAAAGAAAATGCCAAGACGATGGATGGACCCATATCTTAACAGCTCAATTTGGTATCTAAAACTGAAAGATCTGGTGCCCTATGATTCTGGGAAATACACTTGTATAGTGTCCAATCCATATGGCAGTATAAATCATACTTACACGCTTCAGGTTGTTGCTAAACAACGATCACGTCCCATCCTACAAAATGACCTTCCAAAGAACACAACCGTGCAGCTTGGGGATAATGCAACAATGACGTGCATTGTGCTTGTTAGTGGAACACTTCCTGACTTTAAATGGCTGAAGTGGGACAAATCCATCACGTCACTGTCAAACATTGGTGACGATTTGGAGAAGGGATCATACCACCTTATAGACCCACATAATTACAACACTATCCAAGTTAAAGACAGTTATGGCGTTGAGTTGAGAATTCCCAATGTGACAGAGGACGATCTTGGACTCTACACTTGCTTTGTGAGCAATCATATTGGCAAGGATTACAACAGTGCATTCCTCGGCAAAGGTGTGAAACCCACTGTTAGAGTGACAGCACCAACACTTGGAATACCAGCTATGAAGACAGCTTCAGCTGAAGGATTTCGTGCGGCAAGAAAAGAACCTCAGCCAAAACCTGGTCGCAACGTGAACCGTGTGATGCTTTTTGTGACGATACCGTTATGTGGAGCTGTTATTATAACAGCGTTCCTCGCGTGGTATTACTGGCAGATACGAAAAATCAAGAAGAGTGCATCACCCAGAGCTTTAGCGATGGACACGATTGAACAATCAGGACATGCAAGAAAAAAACCACGCAACGAGTATGTCTTCCTCCCCCAGTACTGA

Transcript

OS493_011807-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
D3YXG0	Hemicentin-1 OS=Mus musculus OX=10090 GN=Hmcn1 PE=1 SV=1
Q96RW7	Hemicentin-1 OS=Homo sapiens OX=9606 GN=HMCN1 PE=1 SV=2
A2AJ76	Hemicentin-2 OS=Mus musculus OX=10090 GN=Hmcn2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000215 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07679 all species →	I-set	Immunoglobulin I-set domain	Domain	Interproscan
PF13927 all species →	Ig_3	Immunoglobulin domain	Domain	Interproscan
PF00047 all species →	ig	Immunoglobulin domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007110 all species →	Domain	Immunoglobulin-like domain	Interproscan
IPR036179 all species →	Homologous_superfamily	Immunoglobulin-like domain superfamily	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR013098 all species →	Domain	Immunoglobulin I-set	Interproscan
IPR052615 all species →	Family	Fibroblast growth factor receptor-like	Interproscan
IPR003599 all species →	Domain	Immunoglobulin subtype	Interproscan
IPR013151 all species →	Domain	Immunoglobulin	Interproscan
IPR003598 all species →	Domain	Immunoglobulin subtype 2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19890 all species →	FIBROBLAST GROWTH FACTOR RECEPTOR	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_011807-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K26107	FGFRL1, FGFR5; fibroblast growth factor receptor-like 1	-	Signaling proteins	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011807-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

40.7Max TPM

9.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.13	17.76
polyp at pH7 6	18	18	9.02	20.26
coral polyp · control treatment	16	16	13.47	40.67
coral polyp · oil and dispersant treatment	16	16	9.22	28.68
coral polyp · oil treatment	16	16	11.48	37.91
coral polyp · dispersant treatment	16	16	8.57	17.19
Polyp	10	10	4.61	9.50

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.76
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.18
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.52
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.53
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.94
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.01
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.20
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.71
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.48
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.91
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.83
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.46
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.02
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.71
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.24
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.33
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.53
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.04
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.26
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.62
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.96
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.07
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.18
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.95
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.96
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.35
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.88
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.50
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.40
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.11
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.10
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.97
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.10
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.96
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.10
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.97
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.67
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.90
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.06
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.65
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.92
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.12
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.11
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.93
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.41
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.55
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.41
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.40
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.59
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.06
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.69
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.14
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.68
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.89
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.16
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.04
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.05
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.56
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.20
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.31
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.30
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.01
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.24
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.18
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.09
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.76
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.71
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.40
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.91
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.73
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.95
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.59
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.67
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.56
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.49
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.86
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.41
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.45
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.43
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.27
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.15
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.19
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.84
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.22
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.19
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.57
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.30
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.97
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.87
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.84
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.37
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.95
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.54
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.14
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.98
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.83
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.88
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.82
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.95
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.90
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.50
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.81
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.98
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.83
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.54
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.09
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.35
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.56
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.56
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.84

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.