Gene detail

Detailed information of OS493_011808-T1 in Lophelia pertusa

Genomic Location: scaffold_30:1907431...1918519
NR annotation: KAJ7336592.1, Fibroblast growth factor receptor 4 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011808-T1

ATGCAGGCAAAGCGGTGCTGGTGGATATTGTTGGTCAACCTTATTATCAATACGCAGACTGCTCAACCCGACAAATATCCACCGCGCATTCAAGGTACTCCAAAACTTCAGTATAACGCTGAGGTAGGAAAACTCAAACGATTACGATGTGGAGTGACGGGACTTCCACCACCGACCATTACATGGATCAAGGATGATAAGCCGTTACAGTTGTCAGAAAGAGTAAGGAATTTGAACAACAACAAAACTATAAAGATCAAACAAGTCAGACTTAGTGACCAAGGAAACTACACCTGCATTGCTGAAAATCCTAACGGGAAACTTAGTTTGACTCTAGAACTCAATGTCCGCAAAGGAATCTCCGCCAGTCTTTCGACCTCTCAATTAACATCAACAACTCGAGTACCAACCACCCAGGTACCAGCTAAAGATGTCACAACCTTTTACAAGACTACAGCATCAAGAGGGCCAACCTTTTCTGATCCAAGTATGTTAAAAAGAGCATTTAGAGCATGGCCAGCATCACACTCGATCAGATTGAAGTGTTTAGCAACTGGAGCACCACCTCTCAAATACACATGGCTAAAAGACGGAAAGAAAATGCAAGGGCGACGGATGGACCCATATCTTAACAGCTCAATTTGGTATCTAAAACTGAAAGATCTGGTGCCCAATGATTCTGGGAAATACACTTGTATAGTGTCCAATCCATATGGCAGTATAAATCACACTTACACGCTTCAGGTTGTTGCTAAACCACGATCACGGCCCATCCTACAAATTGACCTTCCAAAGAACACAACCGTGCAGCTTGGGGATAATGCAACAATGACATGCATTGTGCTTGTTAGTGGAACACTTCCAGATTTTAGATGGTTGAAGTGGGACAAATCCATCACATCAATGCCAAAATTTGGTGACGATTTGGAGAATGGATCATACCACCTTATAGACCCACATTATTACAACACTATCCAAGTTAAAGACAATTATGGTGTTGAGTTGAGAATTACCAATGTGACAGAGGACGATTTTGGACTCTACACTTGCTTTGTGAGCAATCATATCGGCAAGGATTACAACAGTGCATTCCTCATCAAATACGTAAAACCCACGGTTCCTGTTAGAGCAGGTTGGGGAACCACAGATGGAAAGGACAACCCTTTACAAAATGGGACAGATTCACCCGTTGAGATCGAACAATTTCAGAGGAACAAGTTAAAGTCGAATCAAGTTGGCTTAGTTGCTATCATACTTCTGGTAGTAGTTGTTTTCATTGCAGTTATTTCGGTTGTTGTGTTTGTTTTCTGTTATCGCAAGAGACTAAAGGGGCAGTTTATTGACGATTCAAAGTCTACAAGACTACATGAAATGGATATGATTCCACCATCATCAACCCTTATACCATCAGAACCTGAAACTCCCAATCAAACTGATGGAACTATGAGAACGTTCAGTTATCCACTTCCAAGAGGAAGATTAAGTTCTACTGGATCTACAAATTCTACAACACCATTACTAAGATACAGAACTGGAAGCTATAGGTCACGATTTTCTTCAGGAGTCTCATCGAGAATTGACTCGAACATTGCTGAAGAGCTTTATGAGCTGCCTTGTGATGAGGAATGGGAAATCAACAGGGCTCAAATAACGATAAGGGAACAACTTGGTGAAGGTGCATTTGGTTTGGTCATGCGAGGTGACGCTGTAGGGTTAACTGACATGCCTTCAACATGTTCAGTTGCAGTAAAAATGCTAAAGGCTGATGCTACTGAGAACGAATTAGCAGACCTTTTGTCCGAGATGGATACAATGAAGGAAATTGGAAGGCACAAGAACATCATCAACTTGATTGGTGCATGCACGCAACATGGTCCTTTGTTTGTCGTTGTCGAGTTTGCACCTCACGGCAACCTTCGGCAGTTCTTGAGAGAAAGAAGACCTTCTGAGTACCAGTACAACAGATTGAGCTATTCTGCCGCCTCCCTCACGATAAGGGATTTTGTGTCTTTTGCTTTCCAAATAGCAAGAGGGATGGAATACCTTGGAACAAGAAAGTGTGTTCATCGTGATCTTGCTGCCAGAAACATCCTTGTTGGGGAAGATTTTGTCATGAAAATCGCTGACTTTGGCTTGGCAAGGAATGTCAGAGACCTGGAGTACTACAGAAAAACCACCGATGGTCGGCTACCGATAAAATGGCTGGCTATCGAGGCATTGTTTGATCGAGTTTACACGACACAAAGTGACGTCTGGGCGTTTGGTATACTGCTTTGGGAGATCTTCACCCTCGGTGGTTCTCCATACCCAGGAATACCTGTAGAAAAGCTGTTCGACCTTTTGAAGTCTGGCTATAGGATGCAGAAACCTCAAAACTGCCCAAGCGATATATACGACATTATGCTGAATTGTTGGGATGAAAACTCCACCAACAGAGCATCGTTCACGGATCTGAGAAAACAATTTGACTCCATGTTGTCATCTATGGCAAGTAAAGAGTATTTGGAAATCTTGGCCCAATCCATCCACGACATAGCACATGACATGGAAACACCCATAACGGACGATTCTGATGTTAATAATGATGCTGTAACGGAGTCCTCGTGCTAG

Transcript

OS493_011808-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8JG38	Fibroblast growth factor receptor 2 OS=Danio rerio OX=7955 GN=fgfr2 PE=1 SV=1
P21804	Fibroblast growth factor receptor 1 OS=Gallus gallus OX=9031 GN=FGFR1 PE=2 SV=1
Q91285	Fibroblast growth factor receptor 1 OS=Pleurodeles waltl OX=8319 GN=FGFR1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000215 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07714 all species →	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase	Domain	Interproscan
PF13927 all species →	Ig_3	Immunoglobulin domain	Domain	Interproscan
PF07679 all species →	I-set	Immunoglobulin I-set domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001245 all species →	Domain	Serine-threonine/tyrosine-protein kinase, catalytic domain	Interproscan
IPR003598 all species →	Domain	Immunoglobulin subtype 2	Interproscan
IPR016248 all species →	Family	Fibroblast growth factor receptor family	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR007110 all species →	Domain	Immunoglobulin-like domain	Interproscan
IPR036179 all species →	Homologous_superfamily	Immunoglobulin-like domain superfamily	Interproscan
IPR020635 all species →	Domain	Tyrosine-protein kinase, catalytic domain	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR008266 all species →	Active_site	Tyrosine-protein kinase, active site	Interproscan
IPR050122 all species →	Family	Receptor Tyrosine Kinase	Interproscan
IPR003599 all species →	Domain	Immunoglobulin subtype	Interproscan
IPR013098 all species →	Domain	Immunoglobulin I-set	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24416 all species →	TYROSINE-PROTEIN KINASE RECEPTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0005007 all species →	Molecular Function	fibroblast growth factor receptor activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0008284 all species →	Biological Process	positive regulation of cell population proliferation	Interproscan
GO:0008543 all species →	Biological Process	fibroblast growth factor receptor signaling pathway	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0004713 all species →	Molecular Function	protein tyrosine kinase activity	Interproscan
GO:0004714 all species →	Molecular Function	transmembrane receptor protein tyrosine kinase activity	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007169 all species →	Biological Process	cell surface receptor protein tyrosine kinase signaling pathway	Interproscan
GO:0007275 all species →	Biological Process	multicellular organism development	Interproscan
GO:0033674 all species →	Biological Process	positive regulation of kinase activity	Interproscan
GO:0043235 all species →	Cellular Component	receptor complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05093	FGFR2, CD332; fibroblast growth factor receptor 2	EC:2.7.10.1	Glycosaminoglycan binding proteins	ko00536	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011808-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

57.1Max TPM

26.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	23.80	37.90
polyp at pH7 6	18	18	27.81	47.42
coral polyp · control treatment	16	16	33.58	55.20
coral polyp · oil and dispersant treatment	16	16	27.97	44.94
coral polyp · oil treatment	16	16	24.16	50.37
coral polyp · dispersant treatment	16	16	33.51	57.07
Polyp	10	10	9.43	21.64

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.90
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.71
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.98
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.28
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.21
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.19
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.59
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.21
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.74
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.98
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.88
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.51
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.15
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.08
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.73
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.08
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.95
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.28
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.42
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.96
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.31
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.42
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.80
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.36
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.98
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.73
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.49
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.98
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.67
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.63
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.66
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.50
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.38
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.53
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.54
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.22
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.20
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.43
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.00
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.12
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.98
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.62
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.83
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.69
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.12
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.77
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.54
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.16
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.71
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.64
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.26
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.26
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.94
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.14
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.57
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.12
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.23
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.26
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.82
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.63
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.74
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.84
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.53
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.86
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.35
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.33
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.09
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.10
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.37
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.86
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.52
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.41
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.72
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.86
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.32
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.29
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.28
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.65
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.20
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.84
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.40
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.59
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.59
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.59
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	57.07
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.26
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.37
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.22
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.61
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.53
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.51
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.70
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.05
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.25
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.69
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.42
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.86
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.68
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.82
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.10
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	21.64
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	16.52
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	15.21
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.18
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.50
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.35
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.55
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.07
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.84
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.44

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.