Gene detail

Detailed information of OS493_011826-T1 in Lophelia pertusa

Genomic Location: scaffold_30:2101097...2104283
NR annotation: KAJ7336608.1, hypothetical protein OS493_011826 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011826-T1

ATGCACTATCGGAAAATCACACACACGCGCATTCTTACCACGGTAACCACTCAAGTCCAACGAGTGGTAACCGTGAGTATCGTCGATAAGGAGTCAGGAGGAGTCGTGCAGGTTGTAACTTACGAAGAGGACGGAGAACCGAAGATCGAGAACAAGGAGGAGGAAAAGGAAGAGGTCGATGAGTTTCTCGAGTCTTCAAGTCTTGATGGCTCGCGTGTGACACTCACTTCAAAATCGCCAAAACGGCAAGAGCAGCAACAGCAAAGCAGAAGTTCTCCGCGAACTAAGAATGTCAAATCTCCTGTTGCCACCAGGTCCGCGTCTAAGTCACTTGAACGGGCTTCTGGTAAGATGCAGGTAGCTATGGCAACACCCGGGACGAGCGGTTCTAACAGAGACTCGAACCAAAGCAGAGATGAGCCTGCAGTTGAAATCCCTGCGGTTACCAGGCAGGCCACCATGCCTGTAGTGGAAGAGGAACCAGGTCTTCAACGCACCTCATCGAGTGATTCATCTCTGACTCCTGGAACCCGTGTGCTGGCAAAGTGGCTAGACAGCTATTTCTATCCAGGAGTAATAACTACAAAGCAGTACAAAAACGGGAGATACTTAGTCACTTTTGACGACGGCGACAAACGAAGGATCCCGCGGGAAAACCTCATCATCAAGGACTTGCTACCCGCGGGACAAAGTGTCATGGTTCAAGGTGAGGACAACTTCTACGAAGAGGGAGTCATCGTTGGCCATTATCGGAATGGTGACGAACGCGGGTACGAGATACAGACCCAGAGTGGCGCTATAAGCCGATACCCGCGGAGCAGAGTTATTTTATCGGAACAGCAAGCAGCGGCAATTGTATCCAGTGAGAGTTCCTTTAACGTTACCAGTGGCTCTAGCCTCAGTATTGGGGCTCATAGCTTGAGGGTGCGGAAGGAAGGGAGTGCTGGGAGTAGCGGCGCAAGTCTGCATGATATCACAAAGTCTGGTAGTACTGGTGTTAAGGACACTTCAAGAGACACTAGCTCTAAAGACACAAGCGAAAGTTCAAGCGACGAGAAGACGCGTGGAAGGAATGCTGCTCGTACCTCGCCACACGCCAGCCCAAGACTATCGAAAACAGCGTCTGCTAGCACGGACATAACGCCGAAATCTACACATAAGTCATCGCATAAGGTCAAAGCGCAAGTGAGACGAGCGGGGTATAGGATTGGTGAAAGTTCATCGAGTTCAGATGAGCAGCACAGTGCCACTGCGGCTAATAGACGACATGTTAGAAGGGGGCTGTCATCTACGTACGGTGCAAAATCACCTGTCAAGATTACGGCCAAGGAGCCGTTCCAGGCCCCGACGCGACGCTCACCGCGTAAACAGATGAGCGGAAAGGAAGACACTGTCGAAACACCTGGAAACCTGCCTGGAAACAGAAACATATTTGCTGGGTTAGCTTTTCTTGTAACAGGTGCAATCCGAGACAAGAACGAGCCTGAGGAATCGGACAGCGAATCAGAGAGAATCGAATTCAATCGCGATCATCTCAAGCGCCAGATCGAGGCCGGAGGCGGCGTCGTGCTGTCGTCGTTTCCTCAATCCCAGATCTCTGGTGCGGAATGCTTCTTAATCTCGCACACGCACCAGCGGACTCAAAAGTATTTCCAGTCCCTCGCTTGTGGAATTCCTTGTGTGTCGCACATGTGGATCAATGACAGTTGTGCATCTGATAAGCGTCTGGACTACAAGCGGTATCTACTTCCGGCAGGGGAAAGCCTGGAGGAGGGCGGAATCGTGGAATGTCGGCCACGTAGAAACATTTTAGGCAATATGCGGGTTTATCTTCACGGGAGCCAGCAGTTTAAAGACACTTGGTCCAGCGTACTGCTTGCTGCTGGATGTAAGATGGTCACCAAACTTCCAAGTCGCGTTGATTATGAGTGCGATGTTGTCATCTGTGAGGATAACAAGCTTCCTGCGAGTGTAACGCACGCCGTTAATGTACTAGGGATTCCTATCGTCTCATTGGAGTGGCTTTTACAGTCACTTATTAACGGACGACAAGTTCAATTTCATGGTCACCCCAAGTACGATTACCGGTTCAAGAATGCGTGA

Transcript

OS493_011826-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P70399	TP53-binding protein 1 OS=Mus musculus OX=10090 GN=Tp53bp1 PE=1 SV=3
Q12888	TP53-binding protein 1 OS=Homo sapiens OX=9606 GN=TP53BP1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006394 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16589 all species →	BRCT_2	BRCT domain, a BRCA1 C-terminus domain	Family	Interproscan
PF18428 all species →	BRCT_3	BRCA1 C Terminus (BRCT) domain	Domain	Interproscan
PF09038 all species →	53-BP1_Tudor	Tumour suppressor p53-binding protein-1 Tudor	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR047252 all species →	Family	TP53-binding protein 1-like	Interproscan
IPR036420 all species →	Homologous_superfamily	BRCT domain superfamily	Interproscan
IPR001357 all species →	Domain	BRCT domain	Interproscan
IPR047249 all species →	Domain	TP53-binding protein 1-like, first BRCT domain	Interproscan
IPR002999 all species →	Domain	Tudor domain	Interproscan
IPR015125 all species →	Domain	Tumour suppressor p53-binding protein-1 Tudor domain	Interproscan
IPR047250 all species →	Domain	TP53-binding protein 1-like, second BRCT domain	Interproscan
IPR014722 all species →	Homologous_superfamily	Large ribosomal subunit protein uL2, domain 2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15321 all species →	TUMOR SUPPRESSOR P53-BINDING PROTEIN 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000077 all species →	Biological Process	DNA damage checkpoint signaling	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0042393 all species →	Molecular Function	histone binding	Interproscan
GO:0045944 all species →	Biological Process	positive regulation of transcription by RNA polymerase II	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20915	TP53BP1, P202; tumor suppressor p53-binding protein 1	-	NOD-like receptor signaling pathway	ko04621	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011826-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

13.5Max TPM

5.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.50	10.77
polyp at pH7 6	18	18	5.65	8.20
coral polyp · control treatment	16	16	7.63	10.87
coral polyp · oil and dispersant treatment	16	16	4.57	7.56
coral polyp · oil treatment	16	16	7.00	12.12
coral polyp · dispersant treatment	16	16	4.60	13.46
Polyp	10	10	3.56	6.25

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.77
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.44
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.43
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.01
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.65
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.15
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.68
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.54
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.50
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.32
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.10
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.04
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.19
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.92
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.40
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.11
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.10
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.58
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.20
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.19
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.80
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.64
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.30
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.05
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.79
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.59
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.84
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.46
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.24
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.59
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.23
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.08
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.01
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.56
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.22
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.86
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.87
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.19
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.15
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.69
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.52
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.23
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.62
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.44
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.19
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.01
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.39
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.88
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.75
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.61
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.45
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.14
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.56
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.93
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.50
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.22
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.90
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.56
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.65
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.53
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.52
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.37
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.79
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.04
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.91
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.77
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.28
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.60
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.12
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.55
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.96
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.06
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.95
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.62
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.49
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.52
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.31
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.95
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.65
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.03
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.74
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.81
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.74
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.43
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.46
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.99
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.52
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.37
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.23
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.72
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.56
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.89
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.40
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.02
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.49
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.34
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.13
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.57
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.43
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.43
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.25
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.27
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.05
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.49
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.49
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.14
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.42
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.98
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.50
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.98

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.