Gene detail

Detailed information of OS493_011828-T1 in Lophelia pertusa

Genomic Location: scaffold_30:2111984...2136951
NR annotation: KAJ7336610.1, Mediator of RNA polymerase II transcription subunit 24 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011828-T1

ATGGTGGTCAACACGGAAATACTTCTTCGAGCTTGGAGAGAGAGATGGACTCCTTTACAGTGGCTTGTAGAAGTGAAAAAGTTAGCAGGAATGGATAACGAAGAACTCCAGGATTTAGCAGAATGCCTTGTTCAACAGGCAACATTTGGTAGTACACCAAGCACTTTAATATTATCATACCTTAATCATGGGATTATGACCAAGGTCATTTCCTGTTCATCAGCTTTGACAGCAGTCCATCAGTTTCAGAATATTATAAAGCACAAGTGCTTGTCAGCTTTGCTTGATCTTCTGCTTAGTTTTGTTCCAACTATAAGTCGTCCAGACAGAGATGAAGAATGCCTGAAGCTAGCAGTTTCCTTGGTCAAGATTGTGTATTGGCTTTTAATTGTGGTTACAAGGCTACTGAAATTGTGTTTAGAGTCAATGCGTCTTTCTGGTGGAGCAAATCTCCCATTTCACCTGTCCAATGCTGGAAAATGTAACAGAGCATTTGGACACCTCATGGGGTCTTCATCTTACAGAGCCATGGTCATTGTAGGAAAGATGGAGCAGCAAGCCATGGCATTTGAATTGGACAGACAGTTGCAAGCTCATCTGAAGGACCTTCTGATGACACAGCCTGAAGGTATCGTCCCTGAAGTGCAGCTCTACATGAAAGAACTCATGGTGAATTTCAGCAGATTACAAAGCTTAAACTCTTCATCTGTTAGTGGTGACATCAGTCCAGGTCATGTTCCTAACATGTCTGTCCAGATTATCACTCAGTTTCAGGTCTTAGTGAGTCCTTCCTACACTCCAAATCAAGTTGCTGATGTGATGGAAGGCATTATGAATACTCAGAATGTGGCGCGGCATCAGCTGTACTTGGAGTTTCTGAGATCAGCCATAGTGGGCCTGTTAGACGCTCCTGACAAATCGATGGAAGCAATATTGTGGGCAGGGTTTTTGTTCCTGAAGGTCCCAATGGTGATTCGTCTCCTAGAGACAAGATCCCAGCCTCCTTTTCAACTCCAGCCCACTCCTGGTGAGCACTCCACTGCACATAATGCATTTCAACAACTACTGCAGTTCGCTCCTCTGCTGGACGATGCAGACCTCAAGTGCAGATGCAACTGCTATAAAGAATTGATCCAACAGTATTACAAAGACCTTAATCAACAGGTTGCAGATAGATTTGGACAGCTTATCTCTCAGAGACTCTTGTCAACTGAAGTACAAAACATGTTAAGTAGCCAGTACTCTTTTAACCACCCGGCCCAGCAAATCCAGGATGAAGAGAACAAAATATTGGAAATAATTGGGGCTCTAGAGTCCGATCTCAGCAGCAGGGATGAGAAGTTTCTGAACCCTCTGTTGAATGTGGAGAAGTTTAGATGGATGACTGTTGCAGCGGCAAGCGTGGGAAAACTTCAGAACCTTATAAGAGGACTGGTTAAAGTTACCGACCAAACTGTGCATGCTGCTACAGACAAAGAAGATGTTAAAAGAGGAAACGTCAGAGGAGAGCTGTTCAACACTTCTTTCTTGTTGTTGTGCCATATTGGACAGGTGTATGGTCGTAAGGTTGTACTGGATGTTGCTAAGACTCGATCACCAATTCCGTTTGTTGTTCAGTGGATTTCTCGTCACATACCAGACATTGAGAAGTGGAGAACGTTTATTCCTGATACACAGCACTCACCCAACCAAGCAGCAGTCAACGAGTTACTCAATCAGTTCTTTAGCAATTCAGCATTTCCTGCAAGCCAAGCCAATTGGGATGAACATTGCATGAACGTGTCCAGTGCCCTGCATCATGTGCTGAAGGCGTGGCAGTGTGACACCAAAGCCGTACCCCCTGATCAGTTACAGAAATTATGTGAGCTTCTCAAGTACGAGGCACCTGCGCTGGCCGTGTGTGCTTGTTCATGGAGCTGTGGGCATATTCACACTCTGACTGCGGAAGAGAGAAAGTATCCCATGCGATTAGTCGGTTTTCTCTTGAATCCCGTCAATCCAAAAGGAATGCCCCAGGGATTTGTAGACAGGTGTGCGATGTTGTTAGAAGTCATAAAAAGAATGTCGTCGAGTGTCGAAGGCAAAGATAATACCTGGGAGAACGATAATCCGATATCAGCTGGCAAGCCTGTATCAAAAACTCTTGGATCGTTATTCACGAACGTTGTCAGAGCGCGGCAGCTTAGCAGTAGGACACTTAAACAGTTTAGACATCTGTTAACCACGGGAGGAAATGAGTGGTTTATTTACAGTATAATTAAGGAAATAATAAAGTTCACCCGGCATGAAGAAATCTTACTTGCAGCTGACTTGGCCAGCAGTCTTCTAACATTTAACGCTGAGAGTCTGGTACCTAGCCTTCTTCAGCAAGTTCTGCCGCTGATCATGAATCACGCAGATGCGGAGACAATATTAGAAGATCCAAAGGGTTGGGCGATTGCTCGACTAATGGCACACGCGGTGTGCCTGGGAATGACCATCGAACAAACACGGTCAAAAGGAGATTTGAGCGATGACCAAAATGAACGCCCGGCCAAAATAAAGAGGCTAGACAGCTTCACTCTTTACAACTCGAAATCTTCATCGCGAGTACAGCAGGCTCTGGTTCGCCTTTGTGAAGATTTTATAGCAACCATGAAAACAACGGAGGTTGGACCAGTGTCAGCGTTACTGGTGTCCTTCCTTCAACAAGCTGTGGCCAGCATTGGTACCAGTATTGGACCACTATCGGCCTGTTTACCTGAAGATTTGGTAAAGGAAATATTGGAGTTATCTCCTAGCCTTCAAAACACACCTGATATACTTTTGGGTTTGTGTAACATGAGGACAACAGAGGGTCGACTGTTATGTGCCAAGGCGCTCTGTAACAGTATTTGA

Transcript

OS493_011828-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004406 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF11277 all species →	Med24_N	Mediator complex subunit 24 N-terminal	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR021429 all species →	Family	Mediator complex, subunit Med24,	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12898 all species →	MEDIATOR OF RNA POLYMERASE II TRANSCRIPTION SUBUNIT 24	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016592 all species →	Cellular Component	mediator complex	Interproscan
GO:0003712 all species →	Molecular Function	transcription coregulator activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15167	MED24; mediator of RNA polymerase II transcription subunit 24	-	Transcription machinery	ko03021	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011828-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

36.2Max TPM

13.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.49	17.93
polyp at pH7 6	18	18	9.80	16.60
coral polyp · control treatment	16	16	16.52	29.17
coral polyp · oil and dispersant treatment	16	16	20.25	36.21
coral polyp · oil treatment	16	16	16.06	24.99
coral polyp · dispersant treatment	16	16	12.81	21.27
Polyp	10	10	7.99	11.54

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.93
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.90
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.88
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.10
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.02
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.74
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.81
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.77
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.68
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.06
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.00
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.73
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.86
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.53
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.10
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.09
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.79
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.76
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.60
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.10
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.87
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.03
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.56
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.60
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.72
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.55
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.38
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.93
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.78
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.64
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.60
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.43
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.34
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.69
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.90
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.63
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.17
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.93
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.85
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.60
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.56
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.69
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.73
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.31
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.17
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.16
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.84
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.46
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.43
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.88
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.44
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.09
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.21
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.10
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.03
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.69
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.17
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.04
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.16
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.19
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.26
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.35
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.32
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.38
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.28
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.05
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.34
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.37
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.99
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.19
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.59
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.48
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.89
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.83
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.60
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.40
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.87
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.29
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.13
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.91
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.64
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.49
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.83
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.82
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.27
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.43
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.69
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.29
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.27
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.94
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.35
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.60
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.49
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.41
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.88
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.70
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.12
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.93
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.02
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.56
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	11.54
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	10.81
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.90
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	9.88
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.96
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.83
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.90
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.17
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.15
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.70

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.