Gene detail

Detailed information of OS493_011949-T1 in Lophelia pertusa

Genomic Location: scaffold_31:37414...44426
NR annotation: KAJ7392293.1, hypothetical protein OS493_011949 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011949-T1

ATGGCCGTCGCCAACAACTCCAAGGAAGGAATGGCACTTGGGCTTAGTTTGCATCTTCGAGCTGAAGAGGCAATAGCAAAGTTCCAGATGGAAATCGAGGATGACTTTAACTACCTTCACGAGATCTTAGCTGAAGCTAAACGGCATTTTGGACGGCGTGACAGCAACATCCTTCTTCCAAAGACACCATCAATGAAAAGGAAGCGCCAAGAGAGTGATGAAGAACAAAGCAGTGATGACAATGCATCTAAAACAACAAAAGCTCACAAGACCCAAGGTTATACATCACCCCTCATGGTTATTACTGAGAATGAGCTGCTGGACTGCAGTGTGACAAATGAAGCAGAAGGTAAGCAAGACAGGGCTAAAAGAACAACAAGAGCAACCAGAGTAAATGCACAGCCTAAACGACAGCAGCCAAAGAGAGGATCAAGGAAAAATAATTTGTCAGATGAGGTACATGTAAGTTCAGCTGAAGATCAAGCTTCCGACCCCTCTTCCATGGATGAAAAACCAAGGCGGAATACCAGAAATTCAAGAAAGAAGTTGGTGAGTTTGACAGAAGAAAAAGGAGCAGGTTCGTCTTCAAGAATAATGATTGAAGACAACGACTTACCCAAAAGAGCGACTAGAAATGCAAGAAAGAAACACTTGGAAGAACATGCACAAGTTTCTTCTGCAGAAGAACTACCTGTTCAACCTGCCACAAAGAAACGTAAGTCAAGCGCAAATACAAGAATGAAGTCTGATTCTGGGGAAATTATGGCGTCAGTAGTCATCAAACAAGAACCTGTGTCACCTCCCGAAGAAATGCAGACAAGAAGAAGCACAAGAAAATCAAGACAGTTGGAGGAGTTGGTAGACAGTGAGGAGAATGAGACGGAAAAAAGAGCTTGTGTTCCAGAAACCCCTGAACCTGTTGTTGAGAATGTTGGATCATCACCTGCATCTGTCAAGACCTGCAAAGCAACCATCAATTTAGTCTTACAATCGCCAGGCTTTAGCATTCCAAACACTAATGAAGCAGCATCAGTAACAACATCAAGTCCCTGTGTTGAGCAAGATCTTGGGTCACATGGAGTCACTGTGGAGGAAAATGATGCGTGTCCTGAAGAGGAAGCCAATAACGATGTTGTTATTGTATGTTCACCAACACCAATCGTACATGTACCTCAGGAATTTGCAGAGACCTGTGTACAAACATTATCTGAAAATAAGGAGGAACTTGAAAATGGAAAGGTGGAAAACTTTGACGCAGTTGATGCAAATGTTGTTGAGTCTAATGAAGTTGTGGATAAAGAAAATACAGAAGAAGCTGATCCTAGAGAAAGGTCTGGAAGAAGAAGCACCCAGAGAAACAGTGGATGGCGAAGAAAGAGCAAAAGATCAAGTCGCTGCTTGTCTCCCGGGAACAAACGTCTGTCTATCAACAAGACAGTGACCAAATCAAAAGTACCAGGAAAGAAGAGCATTGTCAAAAGCTCAGTTAAGTTGAGGTTGACACAGTCTAAACTTATGCCAGAATTGAAGATGAATAACGCTGACAAGTGCAGCGATGATGAAGCACCAGCTGCTAACCTGGAAGATGTTAGAGTGCGTCTGTTTGATAACTTGACAAGCGAGAGCAGTGCAAGCTCTGCCACTAACTCCAGCAGCTGCAGCAGTACCGAGGACAAAGCCGAGGCTCCGGTAGAGACGATTATGGAAGAACACGCAGAGGATGAAAGTGAGGAGGTCTTTCACGATTGTAGAGGATCAGAGAATGAAGCTGACGACAAGACAGAAGATGCAAAATGTACAAAGACAAACAGTAAACATTCACCGATTGTGGAATCTGCCCATTCACCAGTGGCAATTGTGCACTCAAGTCAAGGCAGCAGTTGTAGTGAGGAGTCAGGAGCTGCCTCAGGGGGGATATCTGAGGAACCTACAACACCACCCCCGCAAGAAACTGAGAATCCATCACAGAAGGCCAGACCAAATAACATAGCTCTCGTCCATTCGTTTATCAGGAGGAATACGCCCAAGAAGGTTGACCCAGAGGAAAAGAAAAAGCAACTCCGCATCGCGTTAAAAGAAAAAGAAGAAAAAGAGAAAGGGCGGCGAGAACAATTGGAGATGCAGAAACAGAGAGAAATCGAGGAACGGAAAAGGAGAAGAGAGGAACGAGCGAAAAAGGCGGCGGAGCAGCGAGCGGCTAAACTTCAAGCGCTGGAAGAGAAGAAGCGCCAAGCTCAGGACCAGCGGCATATCTTGGAGGAAAAAGCCAAGAAACTCAAAGAGAAAGAAGACGAAGATAAAAAGAAACAGCGAAACCAGAAAAGAGCAGATCTAGACGCACGAAGAAAGCAAGAAGAGGCTGCTAGACTACAGAGAAAACGAGAGCAAGAGGAAGAAGAAAAAAGACAGCGGGAAATGCTTCAGAAGAAACAAGAGATGGAAGAGCAGGAGAGGCAAAGGAAAATCGCTGAAGCCAAGCGTCACCAAGAACACAGAGAGAAAGAACTGGAGAAGGAACGAGAGTTTGAGAAACAAAGGAAGCTAAAGATAATTGAAGAGAAAGAGAAACGGCTCCGCGAAAAGGAGGAGAAGCAGAGAATTGAACGCGAGAAGAAAGCACAAGAAGACAAAGAGAGGGAGGAGAGGGAGCGGGCGAGAATAGCGCAGCTTATCCGTGAGAAAGAAGAACACGCGCGACGCGAGAGAGAACAGCGCGCGAGGGAAGACAAAGAACGACAAGACAAAGAAAGAAAGCTGAAGGAAGAACGGGAGGCAGCGTTACGCGAAAAGAAACGTCAGGAACAGATGGCAAAGGAAAGAATGCGTGTTCTGGAGGAGCGGAAACTAGCAGAAGAAAACAAAAAAATCGAGTCGAACACGACTTGCGACTCGTACGAAATGACCCCGCCTCCTGTGAAGGTGCGAAAACCTGCCTCACAAGATAACTACAACATTGCAGACCTACATAGCGATGATTCAACTGACGACGAAGATAATCCGAGAAAGAAGATTCCATCATGGGCGCGCCCGGCAGCACTGAAAGCCGCCATTTTTCACCAGGAGTATTCGAACATAGACGTGAACAGTATTTTCGACAGTGTCCCTGCGCCGAACTTGGAAGAAATTTTCACGCAATGCCAGAAGAGGAAGCGGTTCCACCAACGCACAAGCTCAGCGATTTGGGACTCGCCTCCTATGAGGCCGGTTAAGAAAGGAACTTATGTCTAG

Transcript

OS493_011949-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O13024	Inner centromere protein A OS=Xenopus laevis OX=8355 GN=incenp-a PE=1 SV=1
Q32N93	Inner centromere protein B OS=Xenopus laevis OX=8355 GN=incenp-b PE=2 SV=1
Q9WU62	Inner centromere protein OS=Mus musculus OX=10090 GN=Incenp PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006759 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03941 all species →	INCENP_ARK-bind	Inner centromere protein, ARK binding region	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005635 all species →	Domain	Inner centromere protein, ARK-binding domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13142 all species →	INNER CENTROMERE PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000281 all species →	Biological Process	mitotic cytokinesis	Interproscan
GO:0000776 all species →	Cellular Component	kinetochore	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0030496 all species →	Cellular Component	midbody	Interproscan
GO:0032133 all species →	Cellular Component	chromosome passenger complex	Interproscan
GO:0051257 all species →	Biological Process	meiotic spindle midzone assembly	Interproscan
GO:0051310 all species →	Biological Process	metaphase chromosome alignment	Interproscan
GO:1990385 all species →	Cellular Component	meiotic spindle midzone	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11515	INCENP; inner centromere protein	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011949-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

18.2Max TPM

4.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.00	10.36
polyp at pH7 6	18	18	5.95	16.44
coral polyp · control treatment	16	16	5.61	18.15
coral polyp · oil and dispersant treatment	16	16	3.59	17.50
coral polyp · oil treatment	16	16	5.14	13.41
coral polyp · dispersant treatment	16	16	3.10	8.69
Polyp	10	10	3.24	6.79

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.36
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.16
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.98
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.55
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.82
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.45
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.43
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.30
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.81
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.47
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.79
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.79
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.67
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.63
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.24
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.20
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.76
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.68
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.44
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.83
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.62
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.28
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.25
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.97
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.77
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.68
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.92
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.74
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.73
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.52
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.09
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.01
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.98
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.68
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.32
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.24
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.15
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.66
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.22
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.56
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.14
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.90
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.77
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.64
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.00
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.79
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.97
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.45
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.39
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.72
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.11
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.30
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.50
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.20
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.69
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.87
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.33
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.96
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.59
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.57
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.11
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.71
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.46
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.45
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.26
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.24
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.16
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.34
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.41
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.15
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.34
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.08
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.52
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.80
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.38
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.21
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.13
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.69
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.75
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.69
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.53
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.49
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.03
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.02
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.69
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.99
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.39
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.92
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.17
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.10
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.06
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.97
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.89
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.60
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.88
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.38
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.32
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.96
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.74
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.57
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.79
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.47
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.61
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.48
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.29
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.18
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.11
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.92
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.62
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.93

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.