Gene detail

Detailed information of OS493_011950-T1 in Lophelia pertusa

Genomic Location: scaffold_31:44995...73027
NR annotation: KAJ7392294.1, hypothetical protein OS493_011950 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011950-T1

ATGCCGGGAATTGTTGTGTTTAAGCGTCGATGGATGGTCGCAAGCGATGATTTTGTTATTCCATTTGGAATTGCTTTCGTCCTCAGAGGATTATGGATGATTGTATTGTCACTAGCTGTTGGCATTTATCATGGCTTTTATCATGTGCATCTAGCGGATAAAGAAGATAAGCATATCTGCGAACAGACGTTAGACTATTTTATGGGAGGCTATCTAGCACTTCTTTTTGCCACAAATATCATGGAACTGTCGATTGCTTGGATGAGCGTCACCATAATTATCTATTGTACATTTGATTCTGCTGGAAAAACGTGGGTTCGTTTTCGAGAGGCACAGCTAACAGGAGATAGCGTAGATGCATCAGACAGCTACAGTACGTACATTACTCGCAAGTATGAGAAACGCTGGGAAGGATGTTTCAAGCGATGTTTTTGCAGCTCAGGAGTAGGACAAGGAGATGAAAATGTCTTCACCTTTATAGGAAGGAAGCTCGCTGAGTATTTTCAAGATCTGGACGTTGTTCCTTCAGACTTCGCAGCTGGACTTGTTTTGCTAAGAAAGCAGCAAAAACGCCAAGAACACTCTGCTCTGGTGAGGGCAATAGAAGAGCAACAAGTCCTAGATTCTCAGAAAGGTGTTAAAAAATCATCATTACGCTTTCAAAGGACAAACAGTTCAAGAACACTGAACCTTAAAGACAAGAATGAATTGATGCTATTCAAGGAAGTAGTATACTACATGAACTATGCACTGTCTGCTTATGGCTGGCCAATCTATATGAAGAGCAATGTCTCTTGTGGCTGTTGTAAGCTTTTGAAAAGTTTCAGATGTTGTTATCCATGTCGTCATCCAGACCCTAGATCACACAAGTTTGTTGATATTGAAAGTGACAACTGCTGCCGTTGTAATTACTCAGCACTTAAGAGAATTGCGAGCATTCACAACAGAGATGCCATATATGTCAGCTATCACAACAAACTCTTTGAAACTCCTTTCTTTGTGAGTGTGGATCATCTCAAGAAAGCAGTTGTGGTCACCATCAGAGGAACTTTATCACTTCAGGATATCCTTACGGATTTCTCTGTCGATGCGGAGAAAATACCAATAGAAGATGGTGATCCAAATTGGTTTGGACACAAGGGTATGATAAAGGCCGCCTTATACCTCAAGAAAAAACTGGAGAGTGGTGGAATTCTGGCAAAAGCCTTTAATTCTGATCCGGAGAAAAACACTGAATCTTATCGTCTTATTCTTGTTGGCCATTCTCTTGGTGCTGGGACAGCAGCTATCTTAGCCATGTTACTCAGACCGTCCTACCCTGATCTGTTTTGTTATGCTTTCTCACCACCTGGAGCCACTTTAAGCCTTGCAGCGGCGAAGTATGTCCGTGATTTTGTTATTTCAATTGTTATTGGAAAAGACATGATTCCAAGATTAAGTCTCTACACTCTGGAGGACCTACGAAATAAGATCATGGCGGTGATTTCATATTCCACCACTCCAAAATGGAAGATTCTGCGTGGTTGTGTGTGTCGTTGTGCATTCGTTTGCTGTTATGGCTGTAAGTGCGTGAACTGTGACGCTCAGTTACGAGATACCGAGGCGGACTGGGAACACTTTCAGTTGCCTAGCAACAAGAATTCCAAGACACCTAATTTTTACCCTCCCGGGAAAGTCATTCACGTAGTCAAAACGGTCTCTGTTCCAAGTCGATGTGGTCGAAAAGGAACCATATTCGAGCCAGTGTGGGCAGACTTAGAGGACTTCCAGACGATTCAGATCTCAGGCCTCATGTGGGAGGATCACATGCCTGACTTTGTACTAAAGGCTCTTAATCAGTGCCTTCCCTCTAAGGAGCAGGAGGAGAGCATCCTTTGTGCCCCAGATCTACCATGCTCTAACACGTTAGAGGTCCCTCTAACGGGTTTTGTGGAACCCAATCACTTTCTTATGCCAAGTAATCACACCGGCCCAAGATCAATGGAAGAAGACGAAGCTGGAATGGAGAGAGTGACTTCTGCTGACTCTTTAGCTTTAGAGGTGGATCACCCGTTATGGCGGATATCAGTTCTCTCTGCAGAGGCACGTAGAGCACCGATAGCGCGTCCAGAGAGCGGCTTTGAAGATTCCGATTTAGAAGAAAGCGCGCCTTCCTCGCGCGTGTCCGCCAACTGGGTAAGCTACACTCTTCCTTCTCTTCAACAAAGTACCGATAACATTGTTATAGACATGCATCCACGCCCTCGCGCCAACACAGACCTTTCCGATTCACCAGCCTCACAGAGATCCTCGAAACTGCAGCAAATTGCAAACAAGGCTACGTCTGTGAGCTCGATACCCGTGAGCCTTGCTTGTTCCCCACCAAACAGTGATCCGCCGCCGAAACCTCCACGAACATTTGAGACAGAAAAATCCGAAGGTAGACAGAGTTTCCGATACAAACCACCGCCGAAGCCGCCACGAACGTTCGAGTACGACTCGCAAATTCAAGCGAACTTTTCTTCGTCTTTGTACTGGAATTTCCTTCGTCCGCGAGCACGACGATATCGGACTCAATTTTCGTCTCCCGAACTCGACGGAAGCACTCTTTCCACAGACTCGGTGGATGGAAGGGAATCAGAAGAAGTTCTTGATCCTTATAGTCCACACCGGAAACATGGACGGCAATTTAACTTTCGGTCCGTAAACGACCAAGTAGATGATCATATCGATGATAATGACAAGATTTCTCTCTTCTCCAAGCAAACCTCGCATCTTAATGGCGATGCTGTCCGAAGACCGAAGCCGCGCTCGGTCGACTCTTCGGGTCCCGAGTATCGGTTTTCGGTATCAGACTCGGGTCTTAACATTTCGCAGGAAGAGGAGTTCCTTCTGGGATCTGTTAAACCGCGCACTGGGAGGCGAAGAAGAAACCAGCTTTTAAAACAAGCCGCGTCAGAGACATTGCACAACGCATGCGCCAGCATTGAGCGCACTGATCAGCCGCTGGCCAGTCGACAAACTAATGCAAATTTTTTGGAGACAACGTTATAA

Transcript

OS493_011950-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Y4D2	Diacylglycerol lipase-alpha OS=Homo sapiens OX=9606 GN=DAGLA PE=1 SV=3
Q6WQJ1	Diacylglycerol lipase-alpha OS=Mus musculus OX=10090 GN=Dagla PE=1 SV=2
Q5YLM1	Diacylglycerol lipase-alpha OS=Rattus norvegicus OX=10116 GN=Dagla PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001618 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01764 all species →	Lipase_3	Lipase (class 3)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR052214 all species →	Family	Diacylglycerol Lipase-Related	Interproscan
IPR002921 all species →	Domain	Fungal lipase-like domain	Interproscan
IPR029058 all species →	Homologous_superfamily	Alpha/Beta hydrolase fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45792 all species →	DIACYLGLYCEROL LIPASE HOMOLOG-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016042 all species →	Biological Process	lipid catabolic process	Interproscan
GO:0016298 all species →	Molecular Function	lipase activity	Interproscan
GO:0019369 all species →	Biological Process	arachidonate metabolic process	Interproscan
GO:0046340 all species →	Biological Process	diacylglycerol catabolic process	Interproscan
GO:0006629 all species →	Biological Process	lipid metabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13806	DAGL; sn1-specific diacylglycerol lipase	EC:3.1.1.116	Phototransduction - fly	ko04745	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011950-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

23.2Max TPM

7.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.64	10.88
polyp at pH7 6	18	18	5.45	8.06
coral polyp · control treatment	16	16	10.40	23.22
coral polyp · oil and dispersant treatment	16	16	7.17	20.53
coral polyp · oil treatment	16	16	7.65	11.80
coral polyp · dispersant treatment	16	16	7.67	14.75
Polyp	10	10	3.71	7.60

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.88
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.62
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.58
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.89
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.72
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.36
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.04
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.97
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.06
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.69
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.01
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.42
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.00
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.62
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.11
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.47
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.84
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.20
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.06
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.98
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.80
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.82
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.03
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.95
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.55
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.42
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.22
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.60
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.58
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.49
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.40
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.34
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.27
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.27
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.21
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.05
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.22
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.46
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.45
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.44
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.31
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.89
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.16
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.72
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.13
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.89
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.80
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.59
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.47
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.30
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.73
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.79
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.53
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.80
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.76
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.00
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.50
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.06
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.48
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.48
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.35
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.16
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.07
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.72
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.53
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.54
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.12
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.64
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.80
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.88
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.47
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.24
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.10
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.60
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.41
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.93
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.81
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.45
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.94
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.88
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.59
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.38
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.66
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.31
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.75
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.05
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.51
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.86
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.87
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.54
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.28
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.84
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.58
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.43
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.83
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.83
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.75
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.11
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.30
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.16
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.60
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.28
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.74
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.30
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.11
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.61
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.72
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.96
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.03
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.76

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.