Gene detail

Detailed information of OS493_011972-T1 in Lophelia pertusa

Genomic Location: scaffold_31:322329...342844
NR annotation: KAJ7392315.1, hypothetical protein OS493_011972 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011972-T1

ATGGCCCTGACCTGGGCTCTGGAGAAGTGCAACAACTATGAGACGTTCACAAGAAATGTTGAGCTGTTACGACGCACCAGTGATATGTTCTTGCGTCACATGCGAATCATTGAGAGAGTTCAACTTTTCCGTGACCTTTGGGAACAGTGGACAAGCAAAGCCAAGTCCGCTGGAGGGGAACACGAGAATAGATTGAATAACTTTAGAAAGAGTAGAGACAGAAAAGAGAAGAAAGGTTGGGAACATGAAAGGGTGATACGCCTTGAACGAGATAAAAAGAGGGAAGAATTCTTAGCGAAAAAACGGTTTAGACTTCCTAAAATAATTGTTACTCAATATGAAGACAAGCTTGAAACATTTGAGGCTCGAGTACAGAGCTCAAAAAAGCGGGAAACACCGAGTGTGTTGCCAAATTTAGTGAGCATTCCACGTGGTTCTGAAAACGAGAAAGGACGCAAAGAAAGTGATGCTGACTCTCAAGGAAGTAGACTTGAGCTACCCGATTCACAGAGCTATACGCAAGAAGGTTCTTTTGATGATATAGCACAAGCTGATGAACAATATGAGTCACTTTTACTTGAACATGAGAATAAAGAGGAAGCTGTTACTGATGGAGCTGATTCTAACTCACAAGAAACAGATGTTGGAGTTGATATGGAAGATAAGAGTGAAGAAAATGTTTTGGAAAATGATGTCTCTCAGTCGGAAGTAGCAATTGAACCTGAAAGCGATCTAATGTCAGAAAACAGTGTAAATACGAAAATTGATGAACAAAATATTAAACATACAGAACAGGAATTGGACAATCGCTTACATGAGCAAGACAATCAATTTAATGCTGCCAACGAAAATGGCACGGAAGAGTTTGAAGTGAAAGAAAGGGAAGGAAGAGTTGAAGAGAAAGAAAACGAGACTGTAAAAGAGAAGAAGGAAATACAAATGAACTTCCTTGTCCCGCCTAGTGTCACTGTCATGGCTGGTGAAAATGGTTCTGATAATGGCTCGATAGGTGATGCGGACGAAACAGCGTCTTTGATGGGCGCGTTTATCCCAGTGGCAATGGCGTTGGTGGCCACTCAAGGTTATCCCACAGCCAGCAGTGTCAAGGTACACAAGAAAGACAAATGCTGGGTGGAGTCGTACACACTGTCCTTTAGTACAGATGGCTCACAGTGGCAACAGTACACTGAAAATGGCGCTGTCAAGGTTTTTAAGGGAAACAGGAACAACAACTCAGTTGTTATAAACAGTCTGTCACACCCAATGGAAGCAAGATTTGTGCGATTCATACCACAGTCATGGAAAAGCAGCATTGCTATGCGTGTAGAGGTGTACGGAGAGGTTATAGAGTCCGACATGGCGAGGAACACTCCACCGCCGCTAGCTGAAGGAGAAGAAGAAGAACAACACATTCATGAAGTGATCTTAGAAGATGAAGAGGAACAAGAAATGGAAGAGTTTGTTTGTGGTGATGAGAACAAGGAAGTGATTGTTCAACAGGACGCTTGGGAGGAAGAGACTGTGTATTCTGTTGTGGAAACAGCTTCACAGATTCAAAGTAAAGTGGCTGTGGTGTCACGAAGTTCCCAATCGATGATCGATCTCACAGTTCAAGGAGAAAAGCACACTCCTAAGACTAAACGAAGATCCAAGAAGCCCAAACAAGATAAGCAAGAAGAAAATGAAGAAAAGAAGAAAAAGAAAAAGAAGAAGAAGAAGGTTAGAGAGAAAAAGGCCAAAGATCCTCTTGAAACCAGTCTCACTCTGTTGGATGACGCCGAGGAGGAAGAGGGGGCCTCGTCTCCAGAAGAGGAAGAAGAAGAACAACAGGAAGAGACAGAAAGGAACTCACCCTCCCTCCCTGAAATCCCCAAGAGACCAGAGAGTGTTACACGGATACCACCTGCACCCAAACGGACCTTTAGCATGTTCCCAGTCAGAAAAGAGAGCCGCGATGAGCCGTCCAAACCCGCAGTCAGGCGCCGTGCGCAGACTGATGACAGTATCCGTAATGAGCTGATGCGCCAACAGCTGGCAGAGGACAGGAGAAAGAAGCTAGAGGCAGTCATGGACAAACCCAAAAAAGAAATTCAAGCGCAGAGCCCTGTATATGACAGTTATGGTGATTCTAGTGGGTTAGATAACTTTTTGTCAAAGTACTGCATTATAAGTGAAGGACAAGCTAATTACTATCGACGTGTTTTCCAGACTTTTGATGAGGACAAGAATGGAGTTTTGTTCCCCGAAGATCTTCTAGAAGCCCTGGAAAGCGTCAATTCCAACTTACTGTCCGACTCCCACATAAACTACATCTACCGAGTTCTGGAACTGTGTGATTGCAGCTTGGACTCTGGAGTGGATTTCAAGTTGTTCTCCGTTGTTGCTGCATTTTCTCAACGCGTGGCAGTCCTAGATGAATTTGCAAAAATCCTTATTTCGAAGCTGGATTTCAGAGAGCTGGACTTCAAACTGCAAAGAGCAAAGCGACTGTTTCTGTGTTATGTTGACGAAGAAAAGAAGACCATCTCGCTTGAAGAGCTCATGCTAGGACTAACAGCCGGAGGATTAACAACTGATCAAAAAGAAGCCACGTTAAAAATTCCTCGGCAGGACGGCCTCTTTGGACTTTCTAGACTTTTTAACTTACATTCCTTTGTTTATTCACATCCACGATCACATTCTACAAGATCCACTTGGAACTGTTGTTTACAGAGATATCTTAACAGTTTAGAGATCACATCCGGGAGACAGCCATACAGTCGGGAGAACACGTGCCATGTTCGGCAAATCCTCGTAGAAATAACCGATGAGTTTCGGACTCTTATCGTCCAATCGGAAAGCGCCAGCTCGTCGTTATGTGGCTTACGTCATGTTGCTTAG

Transcript

OS493_011972-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P00451	Coagulation factor VIII OS=Homo sapiens OX=9606 GN=F8 PE=1 SV=1
Q06194	Coagulation factor VIII OS=Mus musculus OX=10090 GN=F8 PE=2 SV=2
P12263	Coagulation factor VIII OS=Sus scrofa OX=9823 GN=F8 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006712 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00754 all species →	F5_F8_type_C	F5/8 type C domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000421 all species →	Domain	Coagulation factor 5/8 C-terminal domain	Interproscan
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR008979 all species →	Homologous_superfamily	Galactose-binding-like domain superfamily	Interproscan
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR35538 all species →	LIG_CHAN-GLU_BD DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_011972-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011972-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

38.5Max TPM

11.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.40	15.88
polyp at pH7 6	18	18	7.72	10.68
coral polyp · control treatment	16	16	17.06	38.55
coral polyp · oil and dispersant treatment	16	16	10.09	22.25
coral polyp · oil treatment	16	16	11.65	17.41
coral polyp · dispersant treatment	16	16	14.62	38.06
Polyp	10	10	11.21	22.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.88
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.10
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.98
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.78
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.63
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.98
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.78
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.37
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.33
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.11
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.06
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.01
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.39
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.25
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.57
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.46
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.27
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.22
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.68
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.43
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.17
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.01
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.89
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.57
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.87
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.31
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.31
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.87
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.75
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.39
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.05
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.87
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.87
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.67
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.58
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.75
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.55
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.76
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.96
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.92
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.21
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.06
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.78
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.80
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.12
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.64
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.94
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.74
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.13
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.66
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.12
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.63
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.25
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.82
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.34
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.98
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.54
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.06
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.94
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.56
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.36
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.02
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.89
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.38
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.15
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.30
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.05
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.79
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.41
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.72
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.01
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.15
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.10
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.09
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.80
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.77
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.68
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.38
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.97
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.96
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.46
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.82
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.32
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.71
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.06
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.51
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.88
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.54
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.98
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.88
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.24
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.93
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.28
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.93
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.78
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.17
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.44
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.09
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.92
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.30
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	22.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	15.52
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	14.45
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.24
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	11.65
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.78
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	7.12
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.04
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.51
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.80

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.