Gene detail

Detailed information of OS493_011999-T1 in Lophelia pertusa

Genomic Location: scaffold_31:561634...584958
NR annotation: KAJ7392340.1, Ankyrin repeat and KH domain-containing protein 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011999-T1

ATGTCTATTCACCAGCAACAGAAGTCAGTGGTGAACTCTAGCGCGGTTTTTCCGAACGAAAGGTCGCCATCGATTTCGGATTCGTCAGACGAGGAAGATGATGATTTGGACGACGAAAGCGCCGAACATTCAGCGATGGAGTACATTCTTAGAGCCAAAAGGAGTGAACTCACATCAAAGCTAATGCTATCTGGTTCAGATGGTCTGAGCAATGACTTACGGAAGATGGACCCAGAGACTCAGGCTCGTTTGGAGACTCTTTTAGAAGCCGCAGGTGTTGGTAAACTGGCAGATGGAAAAGCTTTTACTGATCCTGAAGTTCTTCGTCGGTTGACGTCATCTGTTAGCTGTGCACTGGATGAGGCTGCTGCTGCTTTGACAAGGATGAGAACCCAAAATAATGGCATACCATCATCAGCTGGTCAAACTACTGCTGATTCAGGAGCTCGGAGTCTTGCGGAAGCTTGTTTGGAAGGTGACGTCAGTGCTGTGCGGAAGCTGCTTGAAGAAGGCTGGAGTGTACATGAACCAACTGATGAAGGCGAAAGTTTACTTTCTCTCGCTTGCTCAGCAGGTTATTACGAACTTGCCCAAGTACTGCTGGCCATGAATGCAAGTGTTGACGATCGCGGGAGTAAAGGAGACTGCACCCCTTTGATGGAAGCTTCAAGTGGTGGCTATATAGATATAGTTAAGCTGTTACTTGAGCACACTGCCGATGTCAATTCACAGTCGCAAGCCGGGAACACTGCTCTCATCTATGCCTGTTGTGGAGGTTATGAGGATGTTGTAGAGGTGCTCTTAAACCATGGTGCAGATATCGAAGCTCATAACGAGAATGGCCACACACCCCTGATGGAAGCAGCAAGTGGTGGACACGTGAACGTAGCTAAGATGTTATTGGAAAGAGGAGCTTGTATTAACTCGCATTCAAATGAGTTTAAAGAGAGTGCATTGACGCTGGCTTGCTATAAAGGTCACCTTGAAATGGTTAAGTTTTTGCTTGATGCTGGAGCTGATCAGGAGCACAAGACAGATGAAATGCACACAGCGTTGATGGAAGCATCCATGGATGGACATGTGGAAGTGGCTAGGCTTCTTTTGGATCATGGGGCACAGGTTAACATGCCAGCTGATAGTTTTGAGTCACCTTTGACATTGGCAGCCTGTGGCGGCCATGTGGAGCTTGCTGACCTACTTATCAAGAGGGGAGCATTCCTGGAAGAAGTTAATGATGAAGGGTACACGCCTCTTATGGAAGCATCTCGTGAAGGACATCTGGATATGGTTGCTTTGCTACTTGAACATGGAGCCGACATTCATGCACAAACAGAAGAGACTCAGGAGACGGCCTTGAGCTTGGCTTGTTGTGGGGGCTTTCAAGATGTAGCTGCATTTCTTCTTCAAGCAGGTGCTTCCATTGAACAGGGTTCATCAACGCCTCTGATGGAAGCTGCACAGGAGGGCCATGTTGACCTGGTTAAATTCCTACTGGAGCAAGGGGCTAATGTTAATGCAACAACTGCGACTGGTGATACTCCACTATCATTTGCTTGTGAGAATGGTCATACTGATGTTGCTGATGTTCTACTGTCAGCTGGGGCTGAATTGGAGCATGAGTCTGAAGCTGGTCGCACACCTCTCATGAAAGCAGCAAGAGCTGGCCATCTATGTACAGTACAATTTCTCATCAGTAGAGGAGCGGATGTTAGCCGTCAAACCACCATGAATGATCACACTGTACTTTCTCTTGCTTGTGCTGGTGGTCATTTGGCAGTTGTAGAGTTACTGTTAGCACATGGCGCTGACCCTTTGCATAAGCTAAAGGATAATTCCAACATTTTAATAGAAGCAGCCAAAGGAGGCCATGCTGCAGTAATTTGCTTTCTCCTGGAGAATCCCATTGTTTCCAATCCTCCTGAACTACCGCTTCATTCAATGCCAGCTACCCTTCCCACTCCTACTGTTCCACCACCTCGGGTACCCCCTGTTCACGCCACTCAACCACCAGTCATGGAACATCCCGATATGCCAGATATGTGTACTGATGCCTTGATGGACGACCAGCAACTGATGCTGAACCAGTTGTCGGACACGCCATTGTCTCCGCATTCTCCTCTTATGTTGAACTCGCCTGCCAACTTTCTCATGCCGGAAATACCGACCACGTCCTGTTCCACCTCCTCAACCATGCCGTCTGACATGCCAACCAACATGACGTCAACAGCTGTGCAAACCGACAACAAGGTGGTGATTTGTGAGAAGCTACAGCTTATTCAAGGCAAGTTAGCTAAAGCCTTGAAGAACGCTAACCTCTCACTGGAGAACATCCCCCCTGAGCTGCTCCAGAGTGTTAATGAGGAGGTATCGGCACTGAATCTTGATGGAGAGGAAATAGCAGTGCCTCCGTCGCCTTTCTCTATGCCTGTTGGTACTGGAGGGGTGATTGGAGACCAGGATGTCATTGAAGGTTTGATGGTTGCAGAACCTGCACAAACTCTTCATGACACTATTGGAGATATGCTGTCTGAAGATTCTAGTGATGATAGTGGTCCCCCTACCCCTCCCGACCTAAGTACATCATCAGTGCCACTGACCCCCACCCCGTCACCAGCCTCACCTCAGTTTCCACCTATGATTGATGTGGATCAACAGACGGACAGTAACTCGGACACTGCACTCACTTTAGCAGCTGCTGGAGGTCATGATGAGCTTGTAACTCTTCTGCTAGTCAAAGGCTCAGACATTGAGCACAGGGACAAGAAAGGCTGCACCCCACTGATTCTGGCAGCCACAGCAGGCCATGCATCCACTGTTGAGATTTTGCTAGATCATGGAGCAGACATTGAGGCTCAGTCAGATCGTACCAAGGACACTGCACTTTCTCTGGCATGCTCTGGTGGCAGGCAAGAGGTGGTTGAGTTACTGATTGCTAAAGGAGCCAACTTTGAACACCGCAATGTCTCAGATTACACTCCACTGAGTCTTGCTGCATCGGGAGGTTATGTTGGCATCATCAAACTTCTACTGAGCCACGGAGCTGAGATCAATTCTCGCACTGGAAGCAAACTGGGTATATCTCCCTTGATGTTAGCATCAATGAATGGCCACACGGCAGCTGTTAAACTGCTGTTAGATATGGGAAGTGACATCAATGCACAGATCGAGACCAATAGAAACACTGCTCTGACTTTGGCCTGCTTTCAAGGACGGCATGAGGTTGTTAACCTGTTGGTGGAAAGGAAGGCAAATATTGAACATCGTGCAAAGACTGGTTTAACTCCCCTTATGGAGGCAGCTTCTGGTGGGTATGTGGAGGTGGGCAGAATCCTTCTTGACAAAGGAGGTGATGTTAACGCCCCTCCTGTTCCATCCTCTCGGGACACGGCACTGACCATAGCTGCAGACAAAGGACATTACAAGTTTTGTGACTTGTTGTTGTCGCGTGGAGCCATGGTAGATGTAAAGAACAAGAAAGGAAACTCACCACTGTGGTTATCAGCTAATGGGGGTCATCTTGAAGTCTGCCAGCTGCTCTTTAGTTATGGTGCAGATGTCGATAGTCAAGACAACAGAAAGGTGTCGATCTTGATGGCGGCATTCAGAAAGGGCCACATTAAAGTCGTCAAATGGCTTGTTAAGCATGTCCATCAGTTTCCATCAGACTCTGAGTGTACAAGATTTGTATCCACTTTATCTGATAAGGAGCTCTTGAATAAGTGCCACAAGAACATGGAAATAATAATAACAGCTAAAGACCGTCAGGCTGCTGAGGCAAACAAGAATGCATCCATCCTCCTGGAGCAAATCGATTTGGAGAAAGAACGAGAAGAGTTGAAGAAAGCGGCTGCTGCCAGGAAGAGGGACAAGAAAAAACAAAAGAAGAAGAAGAAACTCCAGGCAGAGAAAGATGCAGAAACAAATGTTAAGAACATGGCTGAAAAAGAAAACAGTGATGATAGTAGTGAGCCTGAAAGAAAGATCTCTGTTGAAAATGTTGTCAATACTAACGCTTTACCACCACCACTGAGCACCTCTGCGGTGATTGACAGCAATAGTGTGAGCGGCATCAGGACAAGGAAGTCGTCAACTGGTTCCTTGGATACACTCACAAGTATTGCGATCACTGCTGCTGTCACAACAACGTCAACTGGAAAGTCTACTGATGTGATCAGTGTTATGAAAACCGCTGAGATCACCAAGGTGTCCACCTTGCCGAGTCCTAAGAAAGGTAAAAAACACGAGGATGGCTGGAAAGAAGTTGTTAGAAGGTCCAAGAAAATGTCCGTTTCTTCGTCTGTAATCAGTCGTGTGATTGGTCGAGGAGGATGCAATATCAACGCTATCCGTGAAACAACTGGAGCCCATATTGACATCGATACCAATCGACAGAAAACAACTGGCAGCTGCATAGTTACGATCAAGGGACCTGCTGATGCAACGCGGCAAGCACACCAGCTCATCTCAGCCCTCGTCAAAGACCCCGAGTGCGATATCAATGACGTTCTTCCTCGAAAAAAGCACCTTCATTCTCCAATCAGCCGTTCAGCTGTCGCTACAACAATCACCACATCAGTCACATCCACTGTGTCTCACCACAGAACCCTCTCTGAACCAAAACCCATCACCACGTCCTCTAAAGTACCTTCTACAACGCAGTCCACGCAAACACGAACCACAACGAAAACCACAACAGCTGTTGGCGTGCAAAGCTTGTCCAGCTCTTGGCCCTCTACTAACAGTGTCCCTGTGGCGCACCCTCAGGTAACGACATCCGTGAGCTGCACCTCTGCCAAGAGTACTGTCACGTCATCAACGCATATGCCAAGCACTGCACGATGGGCGACTACAACGCAAACCACGTCTAGTACCACCAAGAAGGCGCCATTGGCTGCTGCGCAAATTGCAGCAACGAGCTCCCATTCGAGTGTTGTTCCTGTGGCTTCAGCCTTAGCGAGGAAGACATCTGGTGGAACTACAAATGCCAGTGGTTCTTCTAGTTCCAGTGTAGTGAAGCCCCCAACTCCTGCCAAACGGCAACTGTTTCCTGAAACACCATCCGAGGCACCGAGACAAGCATCATCAAGTAAAATTGCCAGGGTTGTTAAGGGTTCTCCATCGTATTCATCTGTTGCTATGGGAGTGACAGGAGCCACTGGGGGCAGTGCACTTGAAGGGGTACTACCACTCACAACCTCATCGTCGTCCTTAGTAACAGGCTCTGTCACCACATCCTTGGGTTCTTCAAATCTGCCAGCTGCTATCAGCAATCTCCTGTCGCATGTTGGTCAGACGCTGAGTCCCAGTGTATGGAATGATATCGCGCATCCCAGCAACCGACCCAATGTTGGGCCTGTCTCGGAGCTGGACCATCCCTCGTCTGTGTCCCCGGCTGATCCTATCACACAGCCCCTGTACATCACAACCCCAGGGGCCCTGTTTACCCCTCTCTCGCACGAGGCAGCATCGTCCTCCCCTCCCAACTCCTCTGGCTCCCCAGTGCCAACTACAACACCTTCATCGTCAACATCACCTAACTCCTCCCCCATAGGGACATCGCTTGCCCCTGGGGGGAGTACCTCACTGGTGGAGTCGGGGGATAAACCGTCCCTGCGGCCAATAGGAACCGAGAGGGCATCGAGGAGAGTGTGTGCCAGTCCACTTCCGTCAGTGCCTGGGATATCACCGTTAATAGGAACAGAGGGAACTCAAGTTGCTGGAGTTTGGAGCTACTCGTTTGCCCCAGATCCCACGCTGTCAGCAGGCTGGTCGTCTGCCCCAGTTTCAACTGCGCCCTCACCACCTCTTATCAGCGGCAGTAACTCGTTACCAGGCTCTGAGGAGGAGCAATTTGGTGTGAACCCAGGGGATACGCTTCAAACATTCTTGGAACGGCTTTCGCTCTCGAGCCATCTCGGTCTCTTCCAGAAAAACGAAATAGACCTGGATGCTCTTCTGTTGATGTCGGAAAAAGACTATTCAGATATCGGCCTACCGAAGGGACCTCGGGTGAAGCTGTTGAACAGTACTCGGCAACTTTACACCAGCGACACTCCGGAGTTCAATTCAATCCCGCCTGGTGCCTCCCCCGGTTCAAGACCCGTCGGTCGAAATACTGGGTGGAATCCTCAGGGGGGGATCATCGCGACTTCGACGACAGCAACAACTGTGGCTGCCGGGGTTCCGTTCGGGACGAAAAGGGCACCGGGTCGGAAAGTCGATCCGAGCAAAAGACAGGGGTGGAAATCATGGAGCCGGACAGCGGTTTAA

Transcript

OS493_011999-T1

Protein

OS493_011999-T1

MSIHQQQKSVVNSSAVFPNERSPSISDSSDEEDDDLDDESAEHSAMEYILRAKRSELTSKLMLSGSDGLSNDLRKMDPETQARLETLLEAAGVGKLADGKAFTDPEVLRRLTSSVSCALDEAAAALTRMRTQNNGIPSSAGQTTADSGARSLAEACLEGDVSAVRKLLEEGWSVHEPTDEGESLLSLACSAGYYELAQVLLAMNASVDDRGSKGDCTPLMEASSGGYIDIVKLLLEHTADVNSQSQAGNTALIYACCGGYEDVVEVLLNHGADIEAHNENGHTPLMEAASGGHVNVAKMLLERGACINSHSNEFKESALTLACYKGHLEMVKFLLDAGADQEHKTDEMHTALMEASMDGHVEVARLLLDHGAQVNMPADSFESPLTLAACGGHVELADLLIKRGAFLEEVNDEGYTPLMEASREGHLDMVALLLEHGADIHAQTEETQETALSLACCGGFQDVAAFLLQAGASIEQGSSTPLMEAAQEGHVDLVKFLLEQGANVNATTATGDTPLSFACENGHTDVADVLLSAGAELEHESEAGRTPLMKAARAGHLCTVQFLISRGADVSRQTTMNDHTVLSLACAGGHLAVVELLLAHGADPLHKLKDNSNILIEAAKGGHAAVICFLLENPIVSNPPELPLHSMPATLPTPTVPPPRVPPVHATQPPVMEHPDMPDMCTDALMDDQQLMLNQLSDTPLSPHSPLMLNSPANFLMPEIPTTSCSTSSTMPSDMPTNMTSTAVQTDNKVVICEKLQLIQGKLAKALKNANLSLENIPPELLQSVNEEVSALNLDGEEIAVPPSPFSMPVGTGGVIGDQDVIEGLMVAEPAQTLHDTIGDMLSEDSSDDSGPPTPPDLSTSSVPLTPTPSPASPQFPPMIDVDQQTDSNSDTALTLAAAGGHDELVTLLLVKGSDIEHRDKKGCTPLILAATAGHASTVEILLDHGADIEAQSDRTKDTALSLACSGGRQEVVELLIAKGANFEHRNVSDYTPLSLAASGGYVGIIKLLLSHGAEINSRTGSKLGISPLMLASMNGHTAAVKLLLDMGSDINAQIETNRNTALTLACFQGRHEVVNLLVERKANIEHRAKTGLTPLMEAASGGYVEVGRILLDKGGDVNAPPVPSSRDTALTIAADKGHYKFCDLLLSRGAMVDVKNKKGNSPLWLSANGGHLEVCQLLFSYGADVDSQDNRKVSILMAAFRKGHIKVVKWLVKHVHQFPSDSECTRFVSTLSDKELLNKCHKNMEIIITAKDRQAAEANKNASILLEQIDLEKEREELKKAAAARKRDKKKQKKKKKLQAEKDAETNVKNMAEKENSDDSSEPERKISVENVVNTNALPPPLSTSAVIDSNSVSGIRTRKSSTGSLDTLTSIAITAAVTTTSTGKSTDVISVMKTAEITKVSTLPSPKKGKKHEDGWKEVVRRSKKMSVSSSVISRVIGRGGCNINAIRETTGAHIDIDTNRQKTTGSCIVTIKGPADATRQAHQLISALVKDPECDINDVLPRKKHLHSPISRSAVATTITTSVTSTVSHHRTLSEPKPITTSSKVPSTTQSTQTRTTTKTTTAVGVQSLSSSWPSTNSVPVAHPQVTTSVSCTSAKSTVTSSTHMPSTARWATTTQTTSSTTKKAPLAAAQIAATSSHSSVVPVASALARKTSGGTTNASGSSSSSVVKPPTPAKRQLFPETPSEAPRQASSSKIARVVKGSPSYSSVAMGVTGATGGSALEGVLPLTTSSSSLVTGSVTTSLGSSNLPAAISNLLSHVGQTLSPSVWNDIAHPSNRPNVGPVSELDHPSSVSPADPITQPLYITTPGALFTPLSHEAASSSPPNSSGSPVPTTTPSSSTSPNSSPIGTSLAPGGSTSLVESGDKPSLRPIGTERASRRVCASPLPSVPGISPLIGTEGTQVAGVWSYSFAPDPTLSAGWSSAPVSTAPSPPLISGSNSLPGSEEEQFGVNPGDTLQTFLERLSLSSHLGLFQKNEIDLDALLLMSEKDYSDIGLPKGPRVKLLNSTRQLYTSDTPEFNSIPPGASPGSRPVGRNTGWNPQGGIIATSTTATTVAAGVPFGTKRAPGRKVDPSKRQGWKSWSRTAV

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8IWZ3	Ankyrin repeat and KH domain-containing protein 1 OS=Homo sapiens OX=9606 GN=ANKHD1 PE=1 SV=1
O75179	Ankyrin repeat domain-containing protein 17 OS=Homo sapiens OX=9606 GN=ANKRD17 PE=1 SV=3
Q99NH0	Ankyrin repeat domain-containing protein 17 OS=Mus musculus OX=10090 GN=Ankrd17 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004345 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00013 all species →	KH_1	KH domain	Domain	Interproscan
PF00023 all species →	Ank	Ankyrin repeat	Repeat	Interproscan
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF00536 all species →	SAM_1	SAM domain (Sterile alpha motif)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR047373 all species →	Domain	Mask-like, type I K homology	Interproscan
IPR004088 all species →	Domain	K Homology domain, type 1	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR036612 all species →	Homologous_superfamily	K Homology domain, type 1 superfamily	Interproscan
IPR001660 all species →	Domain	Sterile alpha motif domain	Interproscan
IPR004087 all species →	Domain	K Homology domain	Interproscan
IPR051631 all species →	Family	Ankyrin repeat and KH/SAM domain-containing protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23206 all species →	MASK PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0045087 all species →	Biological Process	innate immune response	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16726	ANKRD17, MASK; ankyrin repeat domain-containing protein 17	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011999-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

80.6Max TPM

51.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	54.16	76.96
polyp at pH7 6	18	18	52.11	69.12
coral polyp · control treatment	16	16	59.53	80.60
coral polyp · oil and dispersant treatment	16	16	52.43	75.47
coral polyp · oil treatment	16	16	52.89	80.58
coral polyp · dispersant treatment	16	16	47.52	63.54
Polyp	10	10	39.87	52.70

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	76.96
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	75.15
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	68.64
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	67.04
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.30
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.04
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	65.63
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	65.59
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.46
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	54.16
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.08
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.94
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.92
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.48
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.74
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.15
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.85
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.73
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	69.12
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	67.68
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	64.11
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	63.11
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	59.22
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.88
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.33
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	53.83
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.73
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.05
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	50.62
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	50.27
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.15
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.90
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.50
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.02
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.03
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.50
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	80.60
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	78.07
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	67.38
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.97
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	64.42
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.28
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.23
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	60.96
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.11
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.74
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.24
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.86
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.77
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.00
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.08
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.79
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	75.47
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	66.19
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.36
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.13
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	54.91
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.39
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.64
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.18
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.34
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.21
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.52
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.20
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.96
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.10
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.29
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.98
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	80.58
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	69.93
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.89
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	60.39
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.43
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.36
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.86
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.83
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.07
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	48.57
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.11
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.97
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.28
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.99
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.72
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.24
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.54
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	62.53
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.74
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	52.44
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.90
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.41
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.15
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.83
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.46
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.71
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.65
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.60
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.47
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.38
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.11
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.46
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	52.70
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	49.98
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	47.42
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	42.80
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	40.61
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	40.48
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	36.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	31.24
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	29.60
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	27.86

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.