Gene detail

Detailed information of OS493_012015-T1 in Lophelia pertusa

Genomic Location: scaffold_31:853674...883222
NR annotation: KAJ7392356.1, hypothetical protein OS493_012015 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012015-T1

ATGGACGGAGAGTGCCTTTCTGTTACTGTGGTAGACAGAGTGACGAAGCTTGACACACTTGGTGGTTATGTTTTCTTGGTGTTTTTGTTGTGCCTTCTGGTTGGGTTTCTCCTCGGGCTTCTGTTAGCCCGCTGTATTCTACGCGAATTAGAGGATCAATACTCTCAAAGGAGGAACAAATCACAATCAGCAACAATTCTACTTGATGTAGAAAATGAGGTTCATATACAAGAGACAACTGGAAGGAAAATGGGCAGTAATAATAGGATTGCTCCAATGCCCACGCGAGCCAAAAACACAACCGAGGTTGCCATAGAAATGGAACCAACTCATCTTAGCACTGGCAGTCTTCACAGTCAGTCAACATGGACAGGAGAACAAGACAACAATAAACAATCAGTTATTTATGCACTGAGCAAGTCTTCAGGAGAGGAGATGGAAGTTGAACTTCAAAATCAGGATTTCAGGTCCATTGAGAACATGGAAACCAACCTTAGACTCCAGAAGAATGAGACATTCCTACAGTTGTTAAAGATGATCCTGAGTTTCTTAGTGAGCAAATCCAAAATAAGTGAAAGATTTCAAAGAGATTCTCTTGCAAAGTATGAGCAGGCAATTGAAGACATAGACAACAATGCAAAGGAAGAAATGAAAGCTGAAGAACAGGAGCTAAGGAACACTATTGTTGATCCAATGGAACTTGACCAAGCCATAGAGAGTCTTCATTCTAAGTATTCCAAGAAAATGACTTCAGAAAGAATGGAACTTCAGAATAAATTGAGAATAGATCTCCTGCAAGACTCAGAACTCTCAGAAGATGAGGCAGAACAGATTGTTGCCAAACTCATGATGAACATGGCCGCTGTAGACAGGCGTTTGGCTGAGGAAGCCAGTCGGCAAAATTTGGTCTTGCATGAAAGACTTGCACGAAGACAAGCACTTGCTCAACAGAGGGTTGCTGATAATCAGCAGGAAAAAGACGAATTTGATGAAAGGTTGAAACAACCACAGAAAAATTTGGACGTTCTGGGCAAAAGAGGAAAGCTCCTGGAAGATCAAAAAGAGAGGATCATGGATGAATACGAACAAGATCTTAGAGTTTTACAAGAGAAACATCAACAAGCAATCCTTAAGAGTCAAAACGATCTGAACGAGAAGCTAAAACGAAAGCGGGAACAAAGAAAGAGAAAACTAGAAATGGAACAAGCAGCAGAAAAGGAGGACTTTGAAAGGAAGGCCAGTCAGCTTATCAGTGAAGGTAACATGACAGCTGAAGACTTCCTGGAGTCAAACCAAAAACTGAGAGTGCAGCAACAAGTTGAGCAAGAAGATGAGGAAGACAGGGCTGATGAGTTAGAAGCAGAGGAGCTTAATAACCTCAGACAGAAATTGGAAGAAAAGAGGCAGCGGAATTTGCAAGAAAGAGAAGAAGCCTTGTTTGAACAGATCAGAAAAGAGGCGCATTTGTCGTCAAAGGAAGCTGAGAAACTGATGAACAAGCATTTGGAAGACCTCAAGGAGTCTAATGACAGGAAGAACCGTGAGCGTGAGAGGCAGCGAGCTATGATTCAAGAGAAACTGGAAGAAAGAAAGCAGAGATGGGAGAGAGACATGGAACGACAACAAGCTGAACAGAGCCAGCTGGTTGCAGAGCAAGAGAAAGCCATCAAACAAGTGTTGAACACTCAGGCAGGACTTGCTGAAGACTTACGTAACCAAGTGATGCTAGAACACGAACAGAACATGATAGCGCTAAACGATCATTTGCAGATGACACGACTGAGACAGCAGAAAAGGTTGGAGCAACGTCTTGCAACCCGGCGAGCCAGACTCGCTGAACTTAGGCAACAAATGGAGAAGGAGCGAGAAGACCATCCCCAGAATGACCCTGAGGCCATGAAGACTCTCACAAGGGTTCAGAACATTGAATATCAAGCAGAAGTGAAGAAAATTGAGGCTGAACATCAAGCTGCTTTAGAAGACTTGAGAAGACGTTTGGCGGCCGAGACAGACGAAGCTTTGAAGGAACAAGATGAGAGACTTGGGAAAATATTGGGCAAATTGCAGGTTGCAGTAGCAAGGCGAGAAGAGATTATAAAGAAGCAAGATGAAGCTATTCGTTCTCTGGAGAAAAAGCTCGTGGAGGACATGACAAGGGAAGGCACTCTGGCTGATGCACAAACAGATAAACTCATGAAACAGCATCAGAAACAAGTGGATAAGTTGAATGCGCACATTGACATGGAAAAGGAGAAGCAAATGCAAAAGATACGAGACAAAATTGCAGCAAAACAGCAGAAAAAAGAGAGAGCTTTGGAAGTGAAAATGCACCAAGAGAAAGAAGAACAAAAGAGTAAAGCAGCGCAGTCCGCTGGATCTAAAATATATGTTCTATTAGCTGAGCAGCGCCACAGAAGAGAGATAGAGGACATGGAGAGTGAAATGCAGCTGGACTTGGCGCGGCAGTTGGAACAGCTCAATAAAGAAATGGAGGAACAACTTCTGACCGACTTGCAGGAAGAAGAGAAGAAGTTCATTGCCACCTTAGCTGAGAATAGTGCAGCTACTGAGGAAGAACTGCTTCAAACAATCAAGAACTCTGCATCGGAGGTGGGAATGGACTCTAAGCTAACGAAGAGTATCGCTAAAGATGTTCGTAAACGAGTGAGAAGCGCCAGAACTCCTGCTCCTGATGTGTGA

Transcript

OS493_012015-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008085 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_012015-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR026501 all species →	Family	Limbin/EvC complex member EVC	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16795 all species →	LIMBIN/ELLIS-VAN CREVELD PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0007224 all species →	Biological Process	smoothened signaling pathway	Interproscan
GO:0060170 all species →	Cellular Component	ciliary membrane	Interproscan
GO:0098797 all species →	Cellular Component	plasma membrane protein complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_012015-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012015-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

76.8Max TPM

13.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.57	20.50
polyp at pH7 6	18	18	12.35	19.98
coral polyp · control treatment	16	16	18.73	76.84
coral polyp · oil and dispersant treatment	16	16	14.08	59.19
coral polyp · oil treatment	16	16	14.22	18.77
coral polyp · dispersant treatment	16	16	11.27	20.14
Polyp	10	10	13.39	30.76

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.50
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.78
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.74
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.09
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.62
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.27
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.02
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.58
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.41
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.69
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.89
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.77
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.65
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.62
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.16
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.07
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.91
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.45
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.98
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.75
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.32
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.56
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.29
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.03
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.86
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.39
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.91
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.85
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.46
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.40
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.36
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.18
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.17
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.07
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.23
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.51
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	76.84
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.52
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.46
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.70
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.45
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.95
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.17
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.23
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.52
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.89
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.93
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.92
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.45
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.37
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.91
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.41
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.19
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.04
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.29
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.70
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.38
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.03
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.88
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.34
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.26
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.94
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.72
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.25
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.05
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.85
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.27
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.06
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.77
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.22
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.79
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.53
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.54
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.84
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.28
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.27
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.84
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.58
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.34
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.53
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.31
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.83
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.09
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.69
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.14
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.76
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.65
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.93
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.20
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.71
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.21
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.19
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.37
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.04
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.78
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.70
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.91
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.89
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.55
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.25
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	30.76
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	25.38
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	19.40
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	18.78
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	13.80
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.25
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.42
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.58
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.27
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.25

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.