Gene detail

Detailed information of OS493_012051-T1 in Lophelia pertusa

Genomic Location: scaffold_31:1262117...1273598
NR annotation: KAJ7392389.1, hypothetical protein OS493_012051 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012051-T1

ATGTTTCATAAAATAAGATCTTTTATCCATGAAGCTGTCGAAGCGCTCGCTCCCGATGTTCCTCCTCAAGAAACATTTGTTTTTCACTGGAAGGCAATTACAAATTATTTTATAGAAGCTACAGATGAGAAAGTTCCTGTGCAGGCCACCAATATTCCATATCATTTGGAGCAAATACTGGACATTCTAAGACATGAGGAAGACGATGAGTTTAGTGGAGGGACAACGGGGCCCTGTCTGGAATACTTGTTACAGCATAAAATTTTGGACACTCTCCACACACTGGGTCGAGCAGATTGTCCACCTGGAATGAAACCGCAAGTGTTGCTGTTTTTTGCAAATTTGCTGGCCAAGATGAAACAACCCCTTCTACCACACATAAGTGTTTACCGACCTGTCCATAGACTAATAAGACTCTGTGGAGAGGTGAAAGCTGCTCCATCTGAGAATGAAGAAATTCAGTTCCTTTGTGTTGTGTGTGCAAAGTTACGACAAGATCCCTACTTGGTAAACTTCTTTCTCGAGACAAACTCTGCTTCTACACCTCTCTTGTCTTCTCGGGCTGGTGAGCCGGCACTAGCTACAACTCCAACGTCATCACCAGAAGACTTAGGTCCCCTGCCTGGTCCTGTTAAAGCCCAACGTGACAAGCCAGATTATACACTGGTTAATTCCCTCCTCAACATATCAAAGAGTGAGGACAGTAGAATAGCAGTGAAGGCTTGTGAGGGACTAATGCTTTGTGCATCTCTTCCCGAGGATCATGCAGCCACTGTAATTATCCTGTACACGCCATTCTGTGAAGTCATGGCAGACAGACTAAACGTGTTATTTGATGCCTTGCCGAAGAATATGGAGCCACTGGATATCTCTGCTGTTGCCGCCAAGTGGGGGCTTGACCATCAGAGTGACGATGAAGATGTGTTGTCATTTCCTGGCAAGAGGCAATTGATCTCTTTCCTCTCCTGGTTGGATTACGTTGACCAGCTCTCAAAAGAAGCCCACAAGCTGGTAGCCAAAGCATTAGCAGTAGGAGTAAGAGAGAGATTTCTTCAGACAATCATTGAGCCATGCCTCATTCAACAATCAGAACTTGGTATTATTACCACAACAGCAGTGTTAAGAAGATGTGTGAAAGCTGTCACCTCACCACAGCTCTTGCAAGAAATCTGTATATTTATTCTTGGTGAGGGGACGTTACCAGAAATTATGTCTCATGCAGGAGACCATAAATTACGGCAAACACTTATTGAAAGATGTGATCACTTATCTGACGAGGTCAGTATAGAAACTTTGAAGCTGTTTGAGACATTGCTCAACAAACCTTGTGACATAATTTTGAACAATCTTATACTCCGGAACCTGAAGAGTAGAAAGTATTATACTGCGCCCACAGTGACCAACGGAGATACAGCAACAAGTAATGGGCCTGTGGCTGAGAATTTGACACCAGTATCACCCGTCGCAAAACTCCCACCATCACCGACATCACCTTCATCTCCTCCACTAACTCCAGATGGCTTGGGACCAGCACAGATGGGTGATAATATTGACAGAGAAGAGGTGGAACAAGTTGTAAATAGTTTTATTTCTCTAGTACCTGATGAAATAAAGACATCAGCGCTAACAGGAGACACTGGTTATGACACTTACTTGAGGGATGCCCATAGACAGTGTACTCAACGTGCTTTACAGACTGATGCTTTTAAATGGCCCTCAACTCCAGTCCCCCCTCATGATGTGGAAGACAGCAGAGATAATTTTTACGAAGGTGCGTTTTTGAGCATGCTCTTCAAGAAACTACAGAGACTCTTAGATCAGCCATATGATGTTAACCTTCAGGTGACAAGTGTGATAGCACTGTTATCTCAGTTCAAGCATCCTCAACTGCAGGAATATCTTCTGAATGCATCCTTGCCACTGGCACCAAACTGTCGCTCTCTTCACTCCACTCTTCAAAATGTTGTTCAAGATCTAAGAGGTAGAATACAAAGATTGCCCAATTTTCAGAGAAATGTTGTTTCTGTTAGAAGGCAATTGATGGGAGTTGCCACATCGCCTGAGCACAAGAGTCTTAGTGAAAGCAACCTTCTTGAAGCTGCAATAGTGCTGGAGGAATTTTGCAAGGAATTAGCTGCCATTGCATTTGTTAAAGCAACAGAGAGAGTGCAGGGCCGGTGA

Transcript

OS493_012051-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8CDM8	FHF complex subunit HOOK interacting protein 2A OS=Mus musculus OX=10090 GN=Fhip2a PE=1 SV=2
Q5W0V3	FHF complex subunit HOOK interacting protein 2A OS=Homo sapiens OX=9606 GN=FHIP2A PE=1 SV=1
A0JPG1	FHF complex subunit HOOK interacting protein 2A OS=Xenopus laevis OX=8355 GN=fhip2a PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003421 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF19311 all species →	KELAA	KELAA motif	Motif	Interproscan
PF10257 all species →	RAI16-like	Retinoic acid induced 16-like protein	Repeat	Interproscan
PF19314 all species →	DUF5917	Family of unknown function (DUF5917)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR045668 all species →	Conserved_site	FHF complex subunit HOOK-interacting protein, KELAA motif	Interproscan
IPR019384 all species →	Family	FHF complex subunit HOOK interacting protein	Interproscan
IPR045669 all species →	Domain	FHF complex subunit HOOK-interacting protein, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21705 all species →	RAI16 PROTEIN-RELATED	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_012051-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K26421	FHIP2, FAM160B; FHF complex subunit HOOK interacting protein 2	-	Cytoskeleton proteins	ko04812	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012051-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

28.2Max TPM

12.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.86	19.35
polyp at pH7 6	18	18	13.93	21.53
coral polyp · control treatment	16	16	16.09	28.17
coral polyp · oil and dispersant treatment	16	16	11.94	20.37
coral polyp · oil treatment	16	16	13.49	18.72
coral polyp · dispersant treatment	16	16	9.21	15.66
Polyp	10	10	9.89	17.18

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.35
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.86
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.85
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.01
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.36
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.32
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.86
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.83
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.49
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.10
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.95
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.57
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.19
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.68
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.52
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.06
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.11
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.43
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.53
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.18
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.46
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.96
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.00
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.13
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.77
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.70
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.48
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.46
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.46
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.19
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.16
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.07
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.86
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.68
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.71
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.89
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.17
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.63
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.39
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.40
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.79
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.10
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.40
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.01
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.26
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.67
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.22
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.04
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.93
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.09
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.83
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.58
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.37
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.66
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.96
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.85
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.16
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.28
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.17
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.86
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.83
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.50
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.74
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.43
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.70
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.90
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.51
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.11
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.72
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.63
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.04
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.60
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.95
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.83
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.17
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.22
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.20
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.84
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.93
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.88
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.83
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.94
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.20
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.82
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.66
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.65
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.64
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.50
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.33
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.21
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.77
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.64
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.46
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.46
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.68
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.14
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.88
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.76
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.71
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.82
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	17.18
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	14.18
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.14
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	12.57
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.70
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.84
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.38
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.21
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.27
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.44

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.