Gene detail

Detailed information of OS493_012057-T1 in Lophelia pertusa

Genomic Location: scaffold_31:1311345...1321530
NR annotation: KAJ7392395.1, Leucine-rich repeat serine/threonine-protein kinase 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012057-T1

ATGTGTCAATCTGAGTCACAACGAGTTTTTGAGTTTTCCTTACTGCCTTATCCAGGGGAAGTGAAAGTCATAAACTTGTCTCACAACAAGATAAAGATGAAGTCGCGTCCTCCGATGTCTGTGTCGAGTAGTGTTATGCTTGAGAACTTGAACTTGTCACACAATGGAGAAAGCTGCTTACCTGAGTGGTTAGGGGATTTCTTTCCCTGCTTAACAAGCCTGTATGTGGTGGGTAATAACATGAAGAATCTGCCGGATTCTGCTTTGAAGCTGCAGCGACTGAAAGTCCTAGACTTGTCAAATAACCAGCTGACAGAGATTCCGTCTAAATTCATTTCAGAATGTTTTTCTCTGGAAACTCTTGTGGCATCAAACAATTGCCTGACAACATTACCTGAGTCTGTTGGCCCATCCTTGACAAATTTAAAAACAGTTCGGTTGAACATAAATAAACTTGGAGAGAACTCATCAAAGAAACAATTTTCAATTCCTCGATTTCTTCTCACACTTCCCAATGTGAAAATTGTGGACCTTTCCAGTAACAATCTGGAAGACGTCCCGCCGCCCATTTCCTGGTCTACACAACAACTGAAAGAGCTTGTGCTAGCTGATAACAAGATCAAAAAGCTCTCTTTGGAGGGGGTAGAGAGTTGGCAACACCTTGAAAGACTGATTTTAAGCGACAACTGTCTGAAGCAAGTACCCAGCAGAATTGGTGAGTTGGCATCCCTGACCTCCCTTGACTTGAGTCGTAACACTGGCATCACACACTTACCAGATGAGATGGGAAGATTGTCCAATCTGTGGGACCTGCAGTTGGTCGGTCTCAGTCTTGATCTGGATTCAGCAATTCTAGAAAGCAAGGCTCAGGAGCTCATCGGATTCTTGCACTCCAAGCTCAAGAATTCTGTACCGTACTATCGCATGAAGTTGGTTGCTGTTGGGCAGACAGGACGAGGAAAGACAACCTTGCTGAACCAGCTACAGGAAAATATTGCTGCAGGACCACACCACGATGTCATGGTGAGAGAATGGTGCGTCAGAGACACAAAGGCTCAGTGCAAGACGTGCCATCGCAAAAGCGTGAACTACGTGATCAGCACGTGGGATCTCAAAGATCGTGTTGACTTATACAGTGCTTTTCAGTGCCTCCTGTCATCAAGGACATTGTTTCTGGTTGTCTATGATGTAAGCAAAGGCGTCGGTGAGATTGATGCTCTTAAGCCCTGGCTCCTCAACATACATGCCTGTGCCCCAGAGGCATCAGTCATGCTTGTGGGTACACATAAAGATAAGGTGCCAAAGGACCAGGTCGCTGAGTTACTCAATGAGATCAAGGTGAGGGCCCTTAGCATGTGTGCTGGTGCCGGCTTCCCCCAGGTCAAGAGCATTGTGGTCCTCGATTGCACTCAAGAAACCTCGGGAGTAAAGTCGCTCCGTGCCAAGATCATGCAGCTCATTACAAGATGCACATGCAAAGGTCATTCCTTGATTGGTCCTAGAGTACCACAGAACTTTGTGCGGCTACAGGACCTGATCTTGCATCACCTTCGCAACGAAGGACAGGAACCACCGAGAATCCTGAGAATGGCCAACATCCGAAAGCTCATTCAGGACAATGAAATACTCATGGATGATACTGAGGTTGAACAAGCTATCAGGTTCTTGAGTGAGGCAGGAGTACTCATCCATGTTGATGATCCAGCCTGTCAGTTGAATGATCTCCTTTTTGTTGACCCCGTGTGGGTGTTCCATCTGTTTGCCCATTTGGTGACAATAAAGGAATGTAAGAATGCCATCCTGGAATTGGAAGATCTTGAGAAATTGGTCCGAGGTGGAAGTGGTGTAGTCAACCTGACTCCAGATCTCATGCCGCAGATAATAAAGCTCCTTGAACACTATTGTGTTGTTCTTCCACTGAGAGATGACAGATACCTTTTGCCATCCTTGCTAAGCAATAAACAGCCCTCAATCAAGATCCCAAACCCAGGATGTAACGTGATTGTGAGACGTATATACCACCTGGCGTATCTGCCCCCTAGTTTCTGGCCACGCCTCATTACCAGAGTGCAGACATTTGTGGTGAACTTGTATATGGACCACAAGGCTCAACTGGAGAGCCCTCGTGAACCACGAGTCCAGCAGTGGAATGAAGGGGTCTTCATGCACTGGACAGACCAAGCATACTTTGTGATCTCTCACGGTTTGATCAATCCCAGCACCGACACCGTAGTAATTACAACACCAAGTACAAAACATGGAGCTAGAATTCTAGCTCATGTGGTGGATCATTTGGATACACTGCTAGAGGAATGGTTTCCGGACTTGTGTGGAGTGGATCCTCAGGAAGGTCTACCTCTTGTCAGGAAGCAGGCTGCGTGTCCTGTATGCAATGGAGACAATGCTCACACTTTCGACCTTGACTGCATAGCTAAGGCGAGTGCAAATGAATACATCATGTGCCCCAACACTAAATTGCTGGTGTCCCTGCGCCAGATAGCCCCTGATGTGGTCATGGAAGATGTTGGTGAACACTTCAGGATTGAGGAGAGTAAACTGGTGCTGAATATAAACCGTGCCTCGCTGCTTGGAGACGGGGCCTTTGGAGCAGTGTACAGGGCACTATATCATGGAAAGTCTGTTGCCGCCAAGGTGTTTCATCCGGGAAATGAGTGCAATCCTCACACCTTACTGCGTCAGGAGGTGATGTTCTTACGTAAGTTACGTCATCTGAGCATTATCAGTATGGTCGGCGCATGTGTGAAGCCGTGGTCTCTGATCATGGAGTTGGCTCCGCTGGGATCACTGAGCATGCTTTTAAACAGCGGAACGGCACTGAGCAGAGGAATTCAACACAGAATCGCCTTACAGGTTGCAGAAGGCTTAGCATTCTTACACCATCACATGATTGTGTACCGTGATTTAAAACCTCATAACATCCTGATCTTCTCCCTTTCTGTGGTAAACCTGATCAACGCCAAGATATCCGATTACGGCATCGCTCGGTACGCCACTTGCTGCGGCTTAACCTCCACTGAAGGTACTCCGGGGTATCGAGCACCCGAAATTGCCCGAGGCGACATTGCCTACAACTCGGAAGTCGATATGTACTCATTTGGGATGTTCCTTTACGAGCTTGTGACCGGAGGAACCAAACCATTTGAAGACTTGCGCTTCCGTCACGAACTGGATGCGGCTGTGTTGAAAGGCCGAGCATTAGATCCTATCACGTCATTTGACTGCCCTCCATGGCCTGACTTGGCGGATCTTATTGCGCATGCTCTTGAGCCTCGGCCGAATAGACGAGCAACAGCTGAACAGGCATATTCGCGCTTGTGTGACCCCGAGGTGATCTGTTTGAAGCGTGACATCGCCGTATCCAAGGGACAGACAGTAGAGTGCATGACTGTCCGTCACTTCACTGAAGATAACATACCTAAAGTTGAGGTGTGGGTGGGCAGTGGACAGTCGGATGACCTCAGTGCTCAGGTGACCATAATTGACCTCTCGGACATGGGAGTCAAGGGCTGCACGGGTACATTTATCCGAGACAGACGGGTGAAGAGTATCGTAGCAGTGGATAGCGACACCGTGTTGGCCGGTACCCAGTCCGGTAAAATCTGGGTGTTTGATGCTTGGAACCACGAGTGCCGGTTCTCTCTGCCTAAGTTGCCTGATGCGGTTCTCTGCCTCAGACACTACAAAGTCCAGAAGGTCAACAAGGACAGAGCGAAAGACGGAGCCAAGGACGGAGCTAAGGATGGAGCCAAGAATGTACTGGATGTGGATATAGTGCTGGCAGGGCTCGCTAACGGCCAGTTAGCTGTGTATGACAGTATCCGTCCGTCTGGTAGCCGTCTGGTAGCCGTAGAGGAAGATGCTAAGCCTAAGCTAGCCGTAGAGGAAGATGCTAAGCCTAAGCTTTTTGATTTGTGTCACAGCAAGATCATTGAGGGTACCCCCTGTAAGGATTGTAAGGCGCATCCCTTGGCATGCACGGCTGTTGGCAAGAATAGGTTGTTCTGCGGATGCGGTAACGAAATAGTCGTTCTCAGAATAAAACAGAACGTTGTTATTGACATAGAGAGTCGATGGTTCGTCGAGGACAGGGCCAAGGGGCTTGTTTTAAACATCGCTGTGGGATCCACGTTTGTTTGGATCTCAACTCGTGATAGTCCAGTCATCGAGTGCTGGGATTTCTCCAAGGCCAGGTTACTTGGCTCTGTTGACTGTCTGTCAATTCTCAGAGACTCTGGGTACACTGGAGACTTACGTGAAACACGAGTTGTCAGTCTTCTCCTGTCGCACAAGACTCTCTGGGTTGGACTGGGCACTGGTCACGTGGTTCTTGTAGACCCTTCAACGCGGAAGCCATTGACCTTGATCCACCGTCACGTGTCCGCTGTACGCTGTCTCGCAGACACACGGGGTACCACATCTACTAAGTCGACTTCTCTGGTGTTGACCGGGGGTATGGGGTTTATTGAGAGGCATGGGTGCGAGTGGAAGAAGGCTAACACCGAGTTCGGGTATACACTTGTGTGGGAGGCAGACTTCATGGAACAGGCCAAGCACCTGGAGAGTCACATACGTAAAAGGCGTGAACTTTCAAATACGCTTGTGGAATAA

Transcript

OS493_012057-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5S007	Leucine-rich repeat serine/threonine-protein kinase 2 OS=Homo sapiens OX=9606 GN=LRRK2 PE=1 SV=2
Q5S006	Leucine-rich repeat serine/threonine-protein kinase 2 OS=Mus musculus OX=10090 GN=Lrrk2 PE=1 SV=2
Q3UHC2	Leucine-rich repeat serine/threonine-protein kinase 1 OS=Mus musculus OX=10090 GN=Lrrk1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003638 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08477 all species →	Roc	Ras of Complex, Roc, domain of DAPkinase	Domain	Interproscan
PF13855 all species →	LRR_8	Leucine rich repeat	Repeat	Interproscan
PF16095 all species →	COR	C-terminal of Roc, COR, domain	Family	Interproscan
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan
IPR050647 all species →	Family	Plant LRR receptor-like serine/threonine-protein kinases	Interproscan
IPR020859 all species →	Domain	Roc domain	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR032171 all species →	Domain	C-terminal of Roc (COR) domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR003591 all species →	Repeat	Leucine-rich repeat, typical subtype	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48056 all species →	LRR RECEPTOR-LIKE SERINE/THREONINE-PROTEIN KINASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_012057-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012057-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

48.4Max TPM

20.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	24.19	31.01
polyp at pH7 6	18	18	18.99	27.02
coral polyp · control treatment	16	16	25.26	42.47
coral polyp · oil and dispersant treatment	16	16	13.93	20.60
coral polyp · oil treatment	16	16	20.81	48.38
coral polyp · dispersant treatment	16	16	19.75	35.42
Polyp	10	10	15.25	22.25

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.01
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.93
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.58
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.29
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.66
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.11
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.84
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.38
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.98
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.38
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.94
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.74
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.98
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.73
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.59
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.63
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.99
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.66
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.02
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.02
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.44
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.06
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.71
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.17
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.25
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.52
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.23
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.10
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.57
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.29
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.68
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.64
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.33
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.08
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.55
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.24
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.47
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.14
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.11
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.76
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.23
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.72
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.75
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.38
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.36
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.16
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.66
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.22
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.09
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.11
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.54
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.43
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.60
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.51
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.13
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.22
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.58
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.97
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.16
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.44
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.88
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.37
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.98
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.84
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.79
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.11
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.16
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.15
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	48.38
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.54
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.19
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.10
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.50
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.34
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.23
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.93
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.15
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.83
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.94
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.26
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.92
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.14
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.56
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.04
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.42
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.61
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.66
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.79
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.14
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.54
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.54
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.43
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.11
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.78
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.01
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.37
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.64
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.69
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.72
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.54
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	22.25
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	21.70
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	20.92
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	18.24
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	15.25
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	13.86
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	13.81
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	11.36
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.49
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.63

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.