Gene detail

Detailed information of OS493_012058-T1 in Lophelia pertusa

Genomic Location: scaffold_31:1321688...1327409
NR annotation: KAJ7392396.1, Leucine-rich repeat serine/threonine-protein kinase 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012058-T1

ATGGTCTTTTCTTTAGGAATACAGAACTACAGCTGGACACGACAGGTATTTACTGCCATGACGAGCCACTGTGACAAACCAGAAGTGTTACTTGCATCCTGTCATGCAATGCGAGAGTTGATTGAAATTTGTCCTGCTGTGCTAGATGAAATAGGAGATGAACCAGGTGACAATACCATTCCATTACACCAATGCAGTATGGCCGCCTTGATGTTACACTTGGATGACCCAGAGCTATGTCAGTCAGTGTGCAGAGTCTTGGCATTGATCGTCTGTAATTCCAGCTCATTAAGAGAGTCTTTGATATCCAAAGGATTGTACTTGCACATTGTCCGTGCAATGAAACAACACAAAAGGGATCCAGGGGTTCAGCAGTGGGGTTGTAGAGCACTCCGGGGATTGTCCTTATCTGGATGTGGTCACAAAGAACTCATGATCAATTGTGGAGTTTTAGAGCTGGTCTTCAGATGTACTCACAGGTTTGTAGACAACATTGGTGTACAAGAAGAAGCCATAGCATTGATTGCTTGCTTGGCAACAGATGTTGAGCTTGTCTGGCATCAAAGTGCAGTCGAGGGAATCCATGGCATGATTTTGAATGCCATGAGCAACTTTCCAGACCAGGCATCCCTGTGTGAGATCTCACTGGAAGCTTTGGGTGTACTTACTGCTGCAGAAGAAATTCCAGATCTCCTTGTTTGTGAAAGCCCTGATCACGGTGGTGTGAAGACCATTTTTAATGCAATGACCAAACACAAGTTAGAACCTGCAATACAACAGAAAGGATGCATTCTTACTCAAGTGCTGGCACCCTTGCTGTCTGGTGATCATTGTCAAAATGCAGTGTCCGCCGTCATCGAGGCCATGTGCCAGTTCCCAGAAGACAGAGGCGTTCAAGCAGAAGGCTGCGTAGCCATGCTTATCATTGCTCAAATAGATGAAGGAAAGAGTACAATTTTGGTGAATAACTGTGCACATGAAAGGCTTTTCTTCATAATGGAGAAGTTTGCTGAAGAACCCGAGCTAGTGTTTCTGGCCAGCGAATGCATCCGGTATCTTGGCTGGGAGCGAAATCTGAAAGCGCAAATGTTGTTGTCAGCGTGTGCTGGAGGCCTTCTCAAAGGTGCCGACTGTCTGATTAAGAAGGGTGCAGATGTGAATGCTGGTCATGGGGATAACACTCCACTTTGCCGCGCTTGCCAGAATGGCAAGGAAGAAATGGTGCAGTTTCTTCTGACTCAACCAATTACAGACATTCAGAGTGCACTAAGGCTCTCCCTTGAGATGGGTTATAGTACCATTGTGGGATTGCTGCTGCAGCATCTTGGCCATGATAAAGAAGCTGGTATCATTGCATTTAGGAACCTCCATCTGGGTGACTTGCTCCCGGAATGGATGTCGCCTTCTCTGGCCGGTATAAAGTACTCTCCTCCAGTCCTTGGTGCTGGCTGGACTGAACACCTTGACGATGCCAAGAGAACAATGGAACTAAGAGCCACATTGAGTAGTCACCTGAAAAGAAGAGGAAGTGAAAGTCAATCAACTTTGGACAGTAGTTTAACTGGTTGGCAGGGTGACACAAGCAATGTCTCTTCTGACGCTGATACATCACTTACCCTTGAGTCACTTGATGATTCTGATTCCGACTCTGACGATGATTTGAATGTTCCTGAGCTAACTGAAGAATCGCCATTACGAGCACGTAGTATTAGTGGAGCATCCTTCCCTTACAGCTCACATGATCCTCGCGTTGTGTCCCCCTTCCCAGACAGGAACTACATCATTTTACCCAGGAGTGCATGCAAACGATCATTTGAAGAGCACTTGCCTGATTGCCAGCGGCCAGTGTTGAAGAGGCGTTCAGCCAGTGACATCAATCCGCCCATCACCAGTCTACTAGAAACCCTTTCTGGCAAGGTCTCACCACTGCCACGCACCACTCCAATAGCAGAATCTGAAGAAGATGTGCAGCTACCTGGTGTGTTTAAAATGCCTAATCGTAGCTACGTGTATAGTTGGGAGGCTCAGCAAAGTTACAGAGGACGGTCACTGAGTGCTTGCAGTGAGTATGACAGTGGGAGATTGTTATCCCAATATGCAGGGCGCTCAGATAGAAGAAGCTCCAAGACATGTGAGTCCTTTGCGTCAAGAAAAAGCGAAGGCAGTCAATCAGAGAAATATCTGCAGATGCAACGGTTCGTTTAA

Transcript

OS493_012058-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003638 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22895 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_012058-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012058-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

21.2Max TPM

7.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.05	13.11
polyp at pH7 6	18	18	6.43	11.10
coral polyp · control treatment	16	16	10.03	21.23
coral polyp · oil and dispersant treatment	16	16	6.19	15.56
coral polyp · oil treatment	16	16	6.75	17.87
coral polyp · dispersant treatment	16	16	9.32	17.89
Polyp	10	9	2.68	5.18

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.11
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.12
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.78
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.68
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.23
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.83
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.76
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.69
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.58
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.24
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.23
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.50
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.03
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.01
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.88
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.86
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.40
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.10
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.02
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.54
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.53
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.51
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.12
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.49
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.38
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.30
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.80
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.57
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.15
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.31
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.69
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.18
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.03
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.66
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.30
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.23
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.27
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.23
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.38
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.61
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.89
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.91
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.21
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.05
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.89
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.76
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.18
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.29
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.94
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.27
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.35
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.56
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.14
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.85
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.72
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.95
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.82
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.70
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.79
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.69
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.29
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.87
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.69
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.00
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.73
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.94
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.36
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.87
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.44
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.62
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.08
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.87
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.62
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.71
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.46
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.55
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.37
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.61
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.01
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.45
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.13
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.82
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.47
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.89
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.48
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.48
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.14
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.73
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.10
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.70
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.15
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.75
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.71
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.27
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.89
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.78
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.62
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.52
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.18
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.61
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.63
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.45
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.24
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.71
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.84
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.36
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.76
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.