Gene detail

Detailed information of OS493_012088-T1 in Lophelia pertusa

Genomic Location: scaffold_31:1636646...1643035
NR annotation: KAJ7392425.1, hypothetical protein OS493_012088 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012088-T1

ATGTTGGTGTTTAACAGAGAGCCTGCTGTTGAAAGAGTCATCGAATTTGTGGCTAAGTATGCAACGTTGAAAGATCACCGTATTCCTCAAGTTCAGAAGGATGGCCAGGGAAGTGATGGTGAAGAGGATGATACTAGCAACATCTTTCTTGATTTCATCTTCTCGTTCCTACTGGACTCCCACGACGCTAAAGACAAAGCTGTGCGGTTTCGTGCCTGTCAGCTCATCAACAAGCTGTTGAATAACATGGATGACGATGCTGTGATTGACGATGACCTTGCAGAGAGGATCTTTGAGAGCATGTTGACGCGCCTCCATGACAAGTTCCCTGCAGTGAGGGTGCAGGCGGTTGCAGCGATCTCCAGGCTCCAGGACCCTACAGATGCCGAGTGCATTGTATTATCTACATATTTAAAACTCATGTCTAATGACGCCAGTGCTGAAGTGCGAAGAGCGGTGCTCCTGAATATTGCTCTTTCTTCTCAAACATTAGAGGGAATAATAGGAAGAACCCAAGATGTCACAGAGTCAGTGAGGAAGTTAGCTTATCGCATTCTAGCAGAGAAGGTGAACATCAAATCATTTACCATTGCTCAGCGTGTGGAGCTACTTTCCAATGGATTACATGACAGATCAGAGTCAATCAAGGACGTTTGTGCTAAGGAACTTCTTGGTGGGTGGCTGAAAGGTTTTGACAGGGATTTTGTCGAACTGCTGAAGTGCTTAGATGTGGAAGGATGCACAGAAGTGGCTGAACTGGCTTTGAAGACAGTGCTTAAAGGATTTCCAAAGGAAGATTTACAGGTTTTTACTGAATCTTTAAAGAAAGGACAAGAAGATGAAGGCCCTGTGAGGATCAGCTACAAAAGCCTTGATCCTGAGACAGCATTTTATTGGAGATGCCTCGGAGAACATTTGAAATCCATGGGGGTGGATGGTGAAGCACTCTTGGATGAGCTTCTCCCTGAAGTTTGTGGACAGTTGTTTATGCAGAACATCTCCAGAACAAGATTATTCAGAAAGTCAACAGAAATTATTGCCAGGCAACTATTGACACTGATGGGTGTGGTGGACCTCTCTGATGAAGTTGGAAGGAAGAACCTATGTCAGATGATCCATGACTTGCTGGTACTACCAGAGATCCCAGAGACATTAGTTGATGTCCTTCATGCCAGGTACATGGATGTCCAACCAGAGGAAACAAACAGAATCCAGGAACTTGTTGAAATCATTGCTGATGTCAGACAACCCATTGTCATGATTGAGACTGCTCAGAACAAGGAGGATAAACGGAAATGGGAACTAAAGGTTGCTGGAATCCGTGTCAAGTTGAACCAGTTCCGCGAGGAAATGGAGCAATGTGTGACAAACCAGGATTTTGCACGTGCAGCTGAATTGAAGCAACAAATTGCAGAACTGGAAGAGGAGAAGGAAATACTAGAGTCAGAGGAGAACTCCTTCTCTCAGACTGTCAGGGAAGAAAAGGATGACCCGGATACTCTACTGAAGTGTTTAACTATTGCATCTGAGATGCTACAGGGTGTGGCAACAAGTGGACTGAACCCAACACTAACCACTCTGGTTCAAACATTGATTCTGCCAGGTGTACAGGATGAAGATCCTTTAGTACGTAACATGGCAGTCAAATGCTTGGGCTTGTGTGCTTTACTTTCCTGTGAATTTGCCCGCACACATCTTGTACTTTTCCTTCAGGTGGCTCAACTTGACCAAGAGCTTGTGCGAGTAACAGCTCTCCAGGTTGTTTTTGATCTTCTTCTAAAGTTTGGTCTTGAGGCTTTCAAAGTGAATGCTTCAGTCCCAGAGCTAGAGTGTGACGAACCCAGCACCTCCGGCTCAGAACAGGACAAGACAGGGAAAGAGGATGACGAGAATGAAGAAGGAGAAGATGTCAATGAGAAGAGCCTGGGGAAGATGAAGATGTGGAAGAGAGCCAGGCTCCCGATACAGATACTGCTGCAAAGCAATGACCTTCGCAATGTGGCTGCTGAGGGGCTGGCTAAGTTGTTGTTGTCAGGTCGTGTTCTTAGTGCCAAACTTTTCTTGCGACTTCTGCTACTGTGGTATAATCCCACCACTGAAGATGACGTCAACCTGCGGCACTGCCTGGGTGTCTTCTTCCCTGTGTTTGCCTTTGCTTCACGGTATGTGTGA

Transcript

OS493_012088-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9BPX3	Condensin complex subunit 3 OS=Homo sapiens OX=9606 GN=NCAPG PE=1 SV=1
Q9YHB5	Condensin complex subunit 3 OS=Xenopus laevis OX=8355 GN=ncapg PE=1 SV=1
Q10429	Condensin complex subunit 3 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=cnd3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004586 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02151 all species →	UVR	UvrB/uvrC motif	Family	Interproscan
PF12719 all species →	Cnd3	Nuclear condensing complex subunits, C-term domain	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001943 all species →	Domain	UVR domain	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR027165 all species →	Family	Condensin complex subunit 3	Interproscan
IPR025977 all species →	Domain	Nuclear condensin complex subunit 3, C-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14418 all species →	CONDENSIN COMPLEX SUBUNIT 3-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000793 all species →	Cellular Component	condensed chromosome	Interproscan
GO:0000796 all species →	Cellular Component	condensin complex	Interproscan
GO:0007076 all species →	Biological Process	mitotic chromosome condensation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06678	YCG1, CAPG; condensin complex subunit 3	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012088-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

103TPM > 0

7Conditions

26.6Max TPM

2.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	17	1.77	3.15
polyp at pH7 6	18	16	1.76	5.14
coral polyp · control treatment	16	16	4.00	26.63
coral polyp · oil and dispersant treatment	16	16	3.07	18.41
coral polyp · oil treatment	16	16	2.64	5.52
coral polyp · dispersant treatment	16	15	2.52	5.07
Polyp	10	7	0.91	2.16

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.15
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.88
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.72
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.55
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.38
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.15
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.14
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.04
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.82
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.53
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.48
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.20
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.08
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.93
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.77
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.77
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.14
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.93
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.66
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.55
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.52
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.40
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.02
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.86
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.82
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.48
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.43
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.36
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.19
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.81
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.76
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.75
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.63
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.54
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.19
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.74
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.67
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.40
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.35
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.77
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.62
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.51
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.98
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.57
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.52
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.94
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.46
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.16
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.41
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.16
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.67
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.56
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.65
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.51
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.44
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.39
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.29
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.44
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.32
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.24
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.95
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.50
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.32
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.19
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.52
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.51
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.80
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.24
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.86
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.84
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.55
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.45
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.20
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.14
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.79
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.66
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.65
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.40
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.84
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.77
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.07
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.58
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.34
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.45
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.39
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.32
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.06
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.79
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.45
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.21
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.62
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.59
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.02
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.99
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.44
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.16
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.82
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.59
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.36
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.85
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.64
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.63
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.