Gene detail

Detailed information of OS493_012141-T1 in Lophelia pertusa

Genomic Location: scaffold_31:2258748...2267160
NR annotation: KAJ7392475.1, hypothetical protein OS493_012141 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012141-T1

ATGTTTTCAGGATTTATCAGGCTGTATTTCACAGCCCTTGTTTACACAGGATGTATCATCACGTCTTCGTTGGCCACCAGTCATCAGCTACAAGCTGTATTCAGCATGAGTGGAATAAAGGGTGACGTAATCTTTTCCAAGCCACATGCACAGCATGATGGTCCTACAAGCATCATGATCAACTTAACAGGCATCAACGAGACTCTGAGATGGAGCATTCAACAACTACCTATGATCTACTATGGTAACGCGGCTATGAGCTGCAGAGCAATTGCAGTAGGAGCAGTTTTTGACCCTAAGATGGCCATGATGTCTGGAAACTACAACAGCACGTGCAGTCCATCGAATGCTTCAAGATTCAACGCATGCGCCATTGGAGACTTGACAGGATTGTTTGGATACCTGGACGCCAACACAACACAGCGAAATTATACAAACCAGAACTTGATGATTCCAATCAGAGGCCCGTACAGCATCATGGGAAGGACACTAGTGCTGTACAGCGGCGAAACACCCAAAGCATGCGCACTGATTACTCCTGTCCAGTCCATGATGACAGCCGTAGCTGATTTCAGGGCTCCAGTGGCGGGCTCTATCTACTTGAGACAAGTTGACGAGAACTCGGACACCACTGTCTTCGCTAATGTTTTCTTCGTCGATGGCACCCAGTCTCAAAGAGAGTTTGTATGGCAGATTCAAACATCATCTTCATGCAAAAATGTCAGAGAAAGTTTCAACCCCGACAACAATGATGGGAAAAACTGTAACCAGACACGACACGAAAATTGTTCCATCGGCGATTTGAGCTCCAAACATGGAAATATCACCGTTTCTATGGCGACGAACGGGCATTCCAAAGCCAAAGCGGCCTTTACAGACACCAACTTGCCGCTGAGTGGCGCTAACAGTGTTATCGGCAAGACAATTGTCTTGTTCTCAAGGAACGACACACAGAAGCCTTATGCCTGCGCTATGATCATGAAAGTGAAACCAAAGGTTGTCGAAGCTTCATTCAAGCCTAATGTCCATGATGGCGTAGGTGGATATTTCAAGGTTACTCAACCGTCTGTCTTTGATCCCTCTACAACAGAAATAAACGTGACTGGCTTAAGGGAAGAGTCCCAAGGATACCATGTCCACAACTATCCCAGTCCGTGGCAAATGGATTACACCGGACATGAATCGTGTGCGGGACATTACCTAGGAGGACACTGGAATCCTTTTGGTGTTGATGCTAAATCCAGTCCTGCTCCGGGAAGCGGAACCAATGATGAATACGAAATTGGCGACCTGAGCGGCAAGTATGGATCAATGCTAAACCTCACAACTTACAACGAGAAACACATTGACTACAATCTGCCGTTATTTGGTAAAAACAGCATCCAGGGTCGATCTATGGTTATCCACAAAATGAAGACGATGGGAAGCATGAGATGGGTTTGTGCAGATGTTCATCAGGTGGCGAATGAGGACATGTTTCTTATGAAAACCAAAATAACTTTCAATGGACCGACTCTTAAGGGTTACATTCTATTGATTCAGCACAAGTCCCAAGGAGAATCCATGACATCCGAGGAAACTTCAATTTACATTGATGTCCATTACGTTTCCAACATCAGCAAACAGAGTTTTAATCACAAGTGGCATGTGCATGCGAATCCTGAAGGAGACGACACTTACGCTGCCATGGGTGATAGATGTATGAGTCTAGGAGGACATTACAATCCTTATTACGTCAATTTGAGGGGAGCTTACCACACCGAATGCGTTTCTGATAACATGTTGCGGTGCGAAGTCGGTGATCTTTCCGGCAAGCATGGGATGATGAACGTTGGAACAGGGTCGCAGTTCTACACTGACCCTGGTCTGCCCTTATTTGGAGACATGTCAGTTGTTGGCCGTGGCCTTGTAGTACATGCAGAGAACGCTGGCAAGCCCCGTATTGCCTGTGCTACCATCAAACCAGTGGATTCTTTATACGCAGAGAAAACACTGCACAATGTTGAAGGAGCAGGATTTTCCACAACGAACTTCATAAAAACGGTTTCTGCTGCACTGAATATCCCAAAATGGCGGTTGTTTTATATCAGAACAAATAACAGTAACGTTCAAGGCTGCATGACGGTCAAGTTTGGAATTATTGGAAATGATAAACAAGTCAGTGAGCCTTCCAGAGCTTTTGACCTCATCTTGCAACGCTCACCAGGAAAGCTAAAGGAGTTTCAGCCAAGGAATAAATGCCTCGGCGTTCCTGTCGTTTCAAGTACAGCACCACCAAGCATCAGAAGAACTACTCATAGCGGTGCACGAGCCAATCACGTGAATACCTTAGTCATTCTTAACATGGTTTTACTCACTGTATATGCGTACCTGGGATGA

Transcript

OS493_012141-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O22373	Superoxide dismutase [Cu-Zn] OS=Capsicum annuum OX=4072 GN=SODCC PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001540 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00080 all species →	Sod_Cu	Copper/zinc superoxide dismutase (SODC)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001424 all species →	Domain	Superoxide dismutase, copper/zinc binding domain	Interproscan
IPR053257 all species →	Family	Cu-only superoxide dismutase	Interproscan
IPR036423 all species →	Homologous_superfamily	Superoxide dismutase-like, copper/zinc binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR20910 all species →	AGAP001623-PA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006801 all species →	Biological Process	superoxide metabolic process	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_012141-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012141-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

367.5Max TPM

64.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.29	42.53
polyp at pH7 6	18	18	50.84	144.01
coral polyp · control treatment	16	16	52.27	119.73
coral polyp · oil and dispersant treatment	16	16	112.03	317.85
coral polyp · oil treatment	16	16	50.53	137.32
coral polyp · dispersant treatment	16	16	143.26	367.46
Polyp	10	10	14.86	31.63

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.53
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.52
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.45
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.87
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.21
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.81
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.52
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.31
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.89
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.20
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.07
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.84
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.16
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.13
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.07
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.37
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.72
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.49
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	144.01
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	143.48
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	103.42
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	102.27
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	84.94
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	83.80
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.13
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.85
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.76
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.47
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.87
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.93
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.34
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.83
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.54
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.07
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.41
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.00
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	119.73
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	91.62
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.32
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.62
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	64.75
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.40
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.90
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.33
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.31
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.97
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.78
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.65
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.54
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.29
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.47
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.62
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	317.85
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	219.20
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	192.53
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	186.48
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	145.81
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	137.22
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	113.79
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	97.61
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	71.75
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.63
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.78
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.74
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.11
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.65
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.60
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.68
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	137.32
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	122.92
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	93.50
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	72.07
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.30
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.32
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.61
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.13
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.11
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.01
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.79
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.86
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.45
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.73
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.32
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.02
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	367.46
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	327.14
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	224.60
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	183.57
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	173.95
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	169.92
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	144.35
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	127.40
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	119.56
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	110.38
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	90.47
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	84.27
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	71.84
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.53
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.40
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.26
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	31.63
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	26.77
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	22.77
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	17.06
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	16.14
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	13.76
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	8.05
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.90
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.63
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.95

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.