Gene detail

Detailed information of OS493_012188-T1 in Lophelia pertusa

Genomic Location: scaffold_31:2936667...2945887
NR annotation: KAJ7392517.1, hypothetical protein OS493_012188 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012188-T1

ATGGCGGCCGCGAAGGTGTCTTTCCTGTTTCTTGGAATAGTTGTTCATGTCATCTATCTAGCGTCTATATTTGATATTTATTTTACTTCTCCTCTTGTTCATGGTATGACGCCTTACAAATCAACTCTCAAACCGCCTGCAAAGAGGCTGGTCTTATTTGTTGCTGACGGCCTGCGAGCGGACAAATTTTATGAACTTGATGAACACGGAAAAACTCGCGCGCCGTATTTCAGAGATTTGATCGAGAAAAAAGGCAGCTGGGGCGTGTCACACACACGAGTTCCTACAGAGTCTCGTCCTGGACATGTTGCTGTTATCGCTGGATTTTATGAGGATGTTAGCGCCGTGGCTAAAGGTTGGAAAGAAAACCCAGTAGAGTTTGATTCAACCTTCAATGAAAGCCGCTACACATGGGCATGGGGAAGCCCTGATATCCTGCCAATGTTTGCCAAGGGAGCCAGTGGGGGACATGTCTTCACTTCCTCGTATAAAAATGTTGAGGAAGACTTTGGAAATGAGGATGCTGCTAAACTTGACACTTGGGTGTTTAATGAAGTCAGAGGATTCTTTGATACTGCAAGGAATAATGAGACATTGAAGAAGATGCTTAATGAAGGGCAAATTGTGTTCTTCCTTCACCTTCTAGGACTGGACACCAATGGTCATGCTCACAGACCAACCTCACAAGAATATGTCAAGAATATTGCTGTTGTTGATGAGGGAATAAAAGAAATGGAGAAATTAATTGAGGAATTTTATGAACATGATGGTCAAACAGCATATGTAATGACAGCTGATCATGGTATGACCAACTGGGGCTCTCATGGGGCGGGGCATCCTCATGAGACACTGACGCCATTAGTGGCTTGGGGAGCTGGTGTACAGGGACCCATGATGCCAGTTCATGGTGCTGATATTCCAGATGAGATGCTCGAGTGGAAACTTGATCATCTGAGGAGAACAGATGTCAATCAAGCAGATATTGCACCGCTGATGACCTCCCTGCTTGGTGTACCATTCCCTCTCAACTCTGTGGGCATTTTACCGGTGGAATATCTCAACAATACAGAGCAGTACATCGCAGAGAACCTCTTTCTGAATTCACAACAGATTGTTGCTCAGTATGATGTGAAAGAACTATTACGGAAAGAAACATCTCTATGGTTTTGGCCTTTCACTTTATTGGCAGGTGCAAAGAAAACAGGAATGATTCGTGACATAAAGGAGTTCATGCGAGCCAAGCAGTACAAAGAAGCAGTCAGCCTCAGTAGAGATCTAATAAAGCTTTCATTGGAAGGGCTCAACTACTACCAGAACTATGACAGAGTATTCTTGAATTTAGTGGTTACTCTGGGATTCTTGGGATGGATATTTTGTATTGTGCTTCAAATTATAGAGGAGCATAGTGACGTCATGAAAGAGACGTCCAAACACAACAAAGGAAGCTTCCATCCCTCGGTAAAGATCTCAATTGTAGACACTACTTCTTTTGCTTTAGCTGTTCTCGTCGTTCTTTTGTTGTTGGTTCAGAAAGCACCGTGGATGTATTTCAGTTACTGTTTGATGCCGTTGGTGTTTTGGAACCGCATTGTGAAGAGACTTCACATCATTCACGCTACATTAGAGTACATCCGTGCGAAGAAGATGCAACGTAGAGTGTTGTTTACGCTCTTGTTTGGTGCATTCTCGTTAGAAATTCTCGTGATGAGCTTCTTCAGGCGTGAGATTCTCTCTGTGGGTCTTGTGTGTCTTGCTTTGTGGCCGTTTACCACCCCACTGTACACAAACTGCAGGTCATCAGTGGGGTGTTGGATGGTCCTTAGCTTCGCTCTCTCTGTCTTTCCTATTCTTCCTGTGGTAGGACGTGAAGCGAACTACCTCTTGGTAACCGCGGCGGGAGTTTTAACTTTGGTCGCTTTTGCTTCTCTGCTGCTTTATGCCTACAATATTTCACAGCCACTCAAGGCGGAAATAACCAAATCTTGTAAAATACTGCTTCCTCAAGCGCTACTTACAGGCTTTGCGGTTTATATTGTAAACAGCACCGCATCAAGTCTGCAGCGAAAACTTGGTCTTCCAGTCGTGAACCAACTTGGAAGTTGGACGATTTTCATTTCGTCCTTTTTGCTACCACTGATCAATTCTAGCAATTTAACCATCAGATTGTCGAGTATTGCCATGGCATTTTCCTCGGTGTACTTGCTGATGAGTACTGCTTACGAAGGCCTGTTTTTATTAGTTCTCTCGCTGCTGATGGGTGCGTGGCTGTTATCTGAACATAAACTGTCCGGCAAGACTCTCAACACGCTATTAGAAACGCAACTGAGCAGTGAAAACTCGACGCATCAACCAGCTTGGAAGGTCCTCACAAAAGGCATCGACACCCCGCTCATGAGGAAGCTCACGTTGGAAGACCTTCGCTGCGCGTATTTCTTCGTATTCTTCATCGTAGTGGCGTTCTTCGGAACAGGGAACATTGCAAGCATCAACAGTTTTGATCCCGCGTCAGTTTACTGCTTTTTAACGGTATTTTCGCCATTCATCATGGGCAGTTTACTGCTTTGTAAAGTGTTCATTCCGTTTGTGATTGTAGCGTGCGCGTTCGACGCCATTCACGTGGTTTTATCGATCCCAGTTCAAAGCTTAGTGTTGGTCGTGCTTGCCATGACGGATTTCATGGGACTGCATTTCTTTTATCTCGTGCAGGACAGCGGTAGCTGGCTCGATATCGGAACAAGCATCAGTCACTATGTTATCATGATGGCGTTTATTATATTCCTGCTTCCAATATTCGGTTTAGCAAGACTCTTTACCGGCGCGTCTTTGTCGTTAACGATGAGCAAGAAAAGAGCTTAA

Transcript

OS493_012188-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O95427	GPI ethanolamine phosphate transferase 1 OS=Homo sapiens OX=9606 GN=PIGN PE=1 SV=1
Q9R1S3	GPI ethanolamine phosphate transferase 1 OS=Mus musculus OX=10090 GN=Pign PE=1 SV=2
Q2U0S9	GPI ethanolamine phosphate transferase 1 OS=Aspergillus oryzae (strain ATCC 42149 / RIB 40) OX=510516 GN=mcd4 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007602 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04987 all species →	PigN	Phosphatidylinositolglycan class N (PIG-N)	Family	Interproscan
PF01663 all species →	Phosphodiest	Type I phosphodiesterase / nucleotide pyrophosphatase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR017850 all species →	Homologous_superfamily	Alkaline-phosphatase-like, core domain superfamily	Interproscan
IPR007070 all species →	Family	GPI ethanolamine phosphate transferase 1	Interproscan
IPR017852 all species →	Domain	GPI ethanolamine phosphate transferase 1, C-terminal	Interproscan
IPR037671 all species →	Domain	GPI ethanolamine phosphate transferase 1, N-terminal	Interproscan
IPR002591 all species →	Family	Type I phosphodiesterase/nucleotide pyrophosphatase/phosphate transferase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12250 all species →	PHOSPHATIDYLINOSITOL GLYCAN, CLASS N	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005789 all species →	Cellular Component	endoplasmic reticulum membrane	Interproscan
GO:0006506 all species →	Biological Process	GPI anchor biosynthetic process	Interproscan
GO:0051377 all species →	Molecular Function	mannose-ethanolamine phosphotransferase activity	Interproscan
GO:0016740 all species →	Molecular Function	transferase activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05285	PIGN; GPI ethanolamine phosphate transferase 1	EC:2.7.-.-	Glycosylphosphatidylinositol (GPI)-anchor biosynthesis	ko00563	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012188-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

25.9Max TPM

7.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.40	8.80
polyp at pH7 6	18	18	5.57	8.90
coral polyp · control treatment	16	16	10.16	17.20
coral polyp · oil and dispersant treatment	16	16	11.85	25.90
coral polyp · oil treatment	16	16	7.97	16.43
coral polyp · dispersant treatment	16	16	4.82	8.46
Polyp	10	10	2.96	4.83

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.80
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.70
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.61
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.65
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.72
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.21
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.12
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.64
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.18
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.05
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.41
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.92
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.84
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.80
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.39
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.24
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.18
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.82
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.90
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.32
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.11
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.02
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.02
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.99
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.62
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.40
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.02
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.94
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.72
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.32
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.22
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.19
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.07
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.78
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.33
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.37
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.20
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.83
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.61
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.23
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.13
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.67
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.31
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.74
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.95
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.77
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.52
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.32
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.69
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.87
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.36
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.29
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.90
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.90
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.53
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.63
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.87
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.64
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.78
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.46
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.45
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.66
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.05
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.82
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.90
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.42
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.90
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.72
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.43
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.13
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.92
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.84
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.82
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.11
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.09
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.86
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.68
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.62
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.18
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.87
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.84
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.24
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.94
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.90
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.46
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.21
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.29
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.85
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.79
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.97
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.83
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.73
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.57
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.47
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.36
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.97
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.92
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.75
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.62
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.41
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.83
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.55
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.55
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.23
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.13
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.85
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.44
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.31
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.08
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.59

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.