Gene detail

Detailed information of OS493_012305-T1 in Lophelia pertusa

Genomic Location: scaffold_32:792207...823841
NR annotation: KAJ7385973.1, hypothetical protein OS493_012305 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012305-T1

ATGGCGATTGAAAAGCAGATTTTCTCCTTTATTCTAGCCATTACGTTCTCTTATTTTAATCTGATACGTTGTGAAGTTACAGAAGTTAATCTGGGAGGCACCTGGATCGTTACAAATGCAAATAAAAGCATTTCTGTGCATGGAAATGTTCCCGGAAATGTCCACACAGCTCTGTACGAGAATGGGACTATTATGGACCCTTACTTCCGGTTTAATGATGTCAAATATCGGTGGATAGCTTATGACAACTGGACATACACACGGTCTTTAGAAGTTCCTGAAGATGTCACATCAAAAAGACAGATTCTCCTGGTATTCGAAGGGCTGGATACAATTGCTGCAATTCTGGTGAACAGTATCAAAGTTGGCGAGTCGACAAACATGTTCCACAGGTATATCTTCAATGTTAAGGGTGCTCTCAAGACTGGTTTGAACAGTGTACAGTCCCAGTGCAGCGTGGCGAGTGTCATAGCAACTTCATCAGAAAAAGAGCAATGTTCATTCAGTTGGGATTGGGGACCTGCCTTTGTTCCTCAAGGGATTTGGCGGAATGTCTCTCTGCAAGCTTATGATTCAGCTGTTATAAGGGACATCACAATAACACCCACTAAAGGATCTATTAATATTACGTGGCAGTTATCAGTGACAGCTTTCATAGATGCGGCTGAAGATGGCGTGACTGGGACCCTACTTCTCAGCCTTCCTCAGATGTCTCGCTCACAGAAACTTCCCATTAAATTGCGGCAAGGCCTACAGAAAGTTTCTCTGCCGGTCATGTCTTTTACTGGGAAAGATGATGTAAAACTTTGGTGGCCTCGAGGATATGGAAAGCCTTATCTATACACTGTCAAGGTGGTCTTTGTGAGCCCCTCAGGTCAAGAACAATCAAGCATTAGTCGTAACATGGGTTTCAGGAAAGTCAATCTTGTACAGGAACCAATAAAGGGTGCTCCAGGTCTGGGATTTCACTTTGAGGTGAATGATTTACCAATATTTCTTAAAGGGGCCAATTGGATTCCAGCAGATGCCTTTGAGGACCGTGTAACAAGCTCAGTTCTTAGGAATCTTCTCCAGTCCGCTGTGGATGCGAACATGAATGTCGTGAGGAACTGGGGAGGAGGAATCTATCAACATGACGAGTTCTACAATATAGCGGATGAATTAGGGTTACTTGTATGGGAGGAATTTATGTTCGCTTGCGCCATGTACCCAACAGATGAAGAATTCTTGAACTCGGTCAAAGAAGAAGTACGATATCAGGTGTCCGGACGTCTTCATCATCACCCGTCAATCATATTGTGGAGTGGCAACAATGAAAACGAAGCAGCGCTGGCTGAAAACTGGTACAACACGAGTTCCATGTTTAATAGGTACGCCAACGATTATGTCAAACTCTACATAGACACTATACGAAAGACCCTGGAGGAAGAAGATAAAAGTCGACCTTTCCTCTCCTCATCACCTTCGAATGGAGTAGATACGGAGAGGGAGGGGTGGGTAGCCAAAAAACCAGGAAGCCCCTACTGGGGAGATGTGCACTTCTACAACTATACGATGGATTGTTGGAATAGGACTGGACCTTACAACAGCGCGTTCATGGATCATCGGCAACATCACGGAGACGGTAATGAGCAAATGTTGGATCAAACCAAGAAACACTTTAAACTGTCCAACTCATCGGATTCTTTAAAGAAATTCAAGGACACTCTCTTTATTATCCAGGTGACTCAAGCTCAATGCATGAAGACAGAAACTGAACATTACAGACGTTTACAGAGTGAATTAGTACAGGGTCAAGGAAGAACCATGGGTACAATCTACTGGCAGTTGAACAGTATCTGGCAGGCTCCGACGTGGTCCTCGTTAGAATATGGAGGCCAATGGAAGATGCTTCATTATTTTGTGAAGGATTTCTTTGCTCCAGTGATAGCGTCATCGTACCAGGAGGGCGGCAAGTTTAAACTTTACGTGGTGTCTGATCTTATGAAGCCAATCACAGAAGGTGCAGTGTCCCTTAAGGCGTGGTCATGGTCTTCATTCACACCGCTCTACAGCAGAAACATCGCATTTGACATTGATTCGACAGTCCTCGGTGAGTGGAAACTCGTATACGCAGAGGATTTACAAGCTCTTGTACAAACAAGCAGATGTGAAAGTGCTCGACATTGTGTGTTTACTATGAAACCTTTGGACCAGAGCAGTGGAAAAGACCTGGGACCGACAAACGTGTTCTATCCTTCCAGCTTATCAGAAGCAGTGGGTTGA

Transcript

OS493_012305-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O00462	Beta-mannosidase OS=Homo sapiens OX=9606 GN=MANBA PE=1 SV=3
Q8K2I4	Beta-mannosidase OS=Mus musculus OX=10090 GN=Manba PE=1 SV=1
Q4FZV0	Beta-mannosidase OS=Rattus norvegicus OX=10116 GN=Manba PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003914 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00703 all species →	Glyco_hydro_2	Glycosyl hydrolases family 2	Domain	Interproscan
PF02836 all species →	Glyco_hydro_2_C	Glycosyl hydrolases family 2, TIM barrel domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR017853 all species →	Homologous_superfamily	Glycoside hydrolase superfamily	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR050887 all species →	Family	Beta-mannosidase glycosyl hydrolases	Interproscan
IPR006102 all species →	Domain	Glycoside hydrolase, family 2, immunoglobulin-like beta-sandwich	Interproscan
IPR036156 all species →	Homologous_superfamily	Beta-Galactosidase/glucuronidase domain superfamily	Interproscan
IPR006103 all species →	Domain	Glycoside hydrolase family 2, catalytic domain	Interproscan
IPR008979 all species →	Homologous_superfamily	Galactose-binding-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43730 all species →	BETA-MANNOSIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004567 all species →	Molecular Function	beta-mannosidase activity	Interproscan
GO:0006516 all species →	Biological Process	glycoprotein catabolic process	Interproscan
GO:0004553 all species →	Molecular Function	hydrolase activity, hydrolyzing O-glycosyl compounds	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01192	E3.2.1.25, MANBA, manB; beta-mannosidase	EC:3.2.1.25	Lysosome	ko04142	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012305-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

12.8Max TPM

6.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.38	9.58
polyp at pH7 6	18	18	6.13	9.61
coral polyp · control treatment	16	16	7.95	12.78
coral polyp · oil and dispersant treatment	16	16	5.43	7.89
coral polyp · oil treatment	16	16	7.20	9.64
coral polyp · dispersant treatment	16	16	6.54	11.10
Polyp	10	9	5.43	7.95

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.58
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.27
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.18
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.05
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.79
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.64
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.22
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.13
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.01
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.69
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.49
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.81
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.89
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.49
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.46
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.27
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.78
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.05
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.61
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.37
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.45
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.92
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.37
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.07
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.05
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.86
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.77
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.75
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.72
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.66
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.62
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.23
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.35
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.04
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.93
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.55
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.78
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.48
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.86
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.54
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.43
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.52
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.48
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.21
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.48
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.30
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.56
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.20
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.00
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.82
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.62
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.94
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.89
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.54
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.26
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.23
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.83
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.40
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.84
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.71
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.44
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.79
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.38
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.20
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.14
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.55
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.40
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.36
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.64
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.04
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.64
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.32
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.16
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.91
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.82
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.73
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.38
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.04
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.84
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.66
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.53
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.50
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.07
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.95
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.10
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.37
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.78
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.08
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.42
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.73
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.61
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.47
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.18
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.87
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.20
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.18
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.82
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.84
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.78
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.16
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.95
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.49
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	7.09
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.94
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.46
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.11
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.17
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.44
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.