Gene detail

Detailed information of OS493_012432-T1 in Lophelia pertusa

Genomic Location: scaffold_32:2261460...2312453
NR annotation: KAJ7386091.1, Dedicator of cytokinesis protein 3 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012432-T1

ATGGCTGCCTGGAAGGCGACAAGCGATGCAAAATATGGAGTTGTTGTTTATAATTTTGACGGCAATATCACTTATGGACTACGGTTAACCATAGGTGAGACTGTGCACATTTTGGAAGAATGTGCAGGTTGGTACCGGGGATGTACTTTGCGAAATAAAGCCGTGAAGGGTATCTTTCCAGCAACATATGTTCGCATCAAGGATTGTTCCGTGGAAAATGCTGGGACATCAGGGGAAAGTGTTGTACCAAAGGAAGATGCCACTGTCAAGGAACTGACTTTGATATTGAGAGAGTGGTCCGTCATCTGGAAAGACTGCTACAGGACACAGAAGGTTCGTCTCTTTGAAGCACTGAAGACAATCATGTGGGATTTGGTGGAATGCAGGCAGAAGCTTCTATCTGGCACCCTGACGCAAGACCAAATGGATGACATCAAGAAGAAAACCATCACAAAAATTGATTGGGGTAACAGCAAAATGGGGCTGGATCTTATTCCACGGGTGGATGGAGAAGTAGTTGATGCAGACTCCACAAGTGTTGTTGAGCTCTACAAAGTGCATGTTTCAAGTGCTGAAGCTAATCTCCAAGTATCGGGGAGAGGTAACTTCAAGAAGAGAGCGTCGCGTGGCATCAGCACGGTGATTCACCACGCTTACCTGAACATGACCAGGTTTGGCTGCAGCATTGACGAGAAGTGCCAGTTGTTTTTCTCCATTTATGATGCAAGGGAAGGACGTTTCATCAGTGAGAGATTTCTAGTTGCTATCAGCAAGAGTGACAGTACACAAAAAGTCAACCAACCACAAAAGATTGACAACTCAACCTGTGTTTTCACTGACCTTGGAAGTAAGGACATATCTGCTGAAGCCTACCTTGTTGCTCATATTGTAAGAGTAGGGAGGATGCTTCCCGATGGTTCTTCTAAAAAGGTTTCAACTGCATCATACAGGAGGCCATTTGGGTGTGCTGTGTTGGACATAGTTGATGTTTTGACTGGGAAAGAAGAACTGTTAGAGGAGAAAGAATTCCACATGCCAATCTTCACTTGTAGTGACAGTGATTTCTGGACAGTCCATGACAGTATCATCAAGAAACAAACCAGTAAATACAGTGTACCTAGCTCAAATAGTGGTATTCATGTTTCCTTGAGGGTGTTGCATGGTGACCTGGATAAGATTCAAAGTGAGAATCCCCTATTGTTACCCAAGGGAATTCCAATTGTCAGAAAATTAGGATTCCCTGATGTTATCATGCCAGGTGATATCAGGAATGATATATATGTTACCATGGAAAGAGGAGAATTTGAAAAAGGATCAGGGAAAACCACATCTAAAAATGTTGAAGTTTCCATGTGTGTCATTGGACCAAAAGGCAAAGTTATTGAGGATTGTGTTTTCCTAGGAGCTGGTGGGTCCAGTTTAACAGAATACCAGTCCATCATCTTCTATCACAACAGCAGCCCAAAGTGGAATGAGACCATAAAGATACAGCTTCCCTTTGACAAGTTCCTTGGTTCCCACTTGAGATTTGGCTTCCGACATTTGTCAAAGTTTGAAGAAAAAGAGAAATCTGACAAGACATTTGGTTTTTCATTTGAGAGCCTCATGCGAAAAGATGGGACAACAGTTCCTGACGGAACGCATGATCTGTGTGTGTATAAGTATGATGAAAACTGCTTCTATGACTCAATGACATATCTTCACATGCCGTCAAGTCTGTCACAAATGGCAAACCATGCCAATTCAGGTTCAGATAGATTGGTACGCAACTCCAAGGATACCTTCTTCATCAGAACAATAGTGTGTTCCACAAAGTTGACACAAAATGTGGACCTTGTTGGATTGTTAAGATGGAGATCGCAGAAGCGTCAAGTCCCATCAGTATTAACTTCTTTGCTAAAAATTGATGGCGAGGAAATTGTGAAGTTTCTTCAAGACATTTTTGATGCACTGTTTGCTATTCTGAATGAGAGTGCAGAACAGTATGGTAACCTTGTGTTTCAAGCTCTGGTTTTTATCATTTGCATCCTTTCCAATGAAAAATATCAACACTTTCAAGGTGTATTGACGACATACATCGACAAGCATTTCAGTGCAGCCATGGCACACAAGAAACTAATTAGCTGTTTAAGGCAGGTCCTGAATTATACTGGAGAAAATGACAAGATGGAGAACCTCAAGAACACCATGATGGCCTTAGAATGTCTTTTTAAATTTATTATTCAATCAAGAATGCTGTTGATCAGCATGCATCGAGGACGAGATGTGACAAGTCAAGATTTATTCAGGCAGGACCTGTGGTCTGTATTTACTGATCTTAATGAATTGATGTCTTCACGTCTACCTGATGTTACTGTACAGTCGTTAGCAATGCAGCATTTTGCTGGAATTTATCAAGACACTTTAAAAGTTTTTAGCATTGAAGAACTAAGTATGATTGCTAAGCAATTCCTTCTCAGTGCTGCGAGGGACCAGAAAGCCCTGACCAGTAGTAAACTACAGTTTATTGATGCGACTGTGAAGAGTGAACTCTTTGTGCACAAAGAATCAAGAACAATCTTGATGCCAGTCCTGGTGACTTCCATTCAACAACAACTTATGCAGAAACAAGACATGAGAAGATGTGCAGAAACACTGGGATCAATTCTCACATCTTTGACCACAGGAACTGCAAAGGGTCCAATTGAAGAGGACGTTTACCTCATCGTAAGAACACTGCTGCAGCCTGTGTTTCAAACAGTGATGACAGTGGACAGAACAAGTGAGCTGGCGAGGCATTTTCTGGCAGTGTTGACAAATTTGCTGTGGATCATGACAGACGATCATTACCAGCAATATCTGAAGGAATTCAGAAGCAACAAAGAACTCAAGGATTTCCTGGTCAATGTGTTTGTGGTTTTCATTGAGATAGTCAAGCGTGGAATCTTCCTTAGAGACTGGATTGTCATCATCGTCTTAGGAAACAGTGTGATTCTAAGAGCCATTCAAAATTTTTCACAAGCTCTGGTGGATAATTTTTCTGAAGATAACTTTGACTATCAGTTGTGGAATAGCTACTTCAACTTGTCAGTGTCCTTTCTCACGCAATCACATCTTCAACTGGAGAACTTCACAGAAGTCAAGAAAAACAAGATCATTGACAGGTATGGTGATATGAGGCAAGTTATGGGTTTTGAGATTGTTAACATGTGGCAGACTCTTGGTTCATTTCAGAGACATTTCATGCTTACTATGGTTTGTCCTTTCCTGGAAATGACTCTTGTACCAGAGACAGAATTGCGCAAAGCTACCTTACCAATTTTCTTTGACATGGTGGAATGTGAACTCAAGTCGAAGGGCATGGCAACCATGGTTGAAACCAAAATAGTGAATGAACTTGACAGGCTGGTGAGTGTGGACAGGAAGGGAGACAAGGAATACAAGAAACTCTTCAAACAAATTCTAACGGAAAAGTTTGAAGATGGACTGCTGTTTTGTGAAGAAGGTTTAGCGTTTGTCAGCCGTGTTACCGACTTGCTGGAGTTACTACTGGATTACAGGAGAGTATCCGCTGAAGACGACAGAGAACAGAAAATGAGCTGCCTTGTACATCTTTTGGAATTTTACGAGAAAATCGGTCGTGAAGACATGTACATCAGGTGTATCAATAGACTTTGCGATCTTCACATTGCTGCTGAGAACTTCACGGAAGCTGGAATCACATTCCTGAAACATGCTGAATTACTAAAGTGGCCAGAGACACTGGATGACTCACCTGACTCTTTGAAAGACTTCCAGCTCAAGGAAAAGTTGTATTTGGATGCCATTGAGTTTCTCGATAAAGGAAAGACATGGGAGAAGGCGATTGAGCTGTGTAAAGAGCTGACAGAGCAATACGAATCGCCGCTATTCGACTTTATTAAACTTGGGGACATTCTGAAAAAACAAGCCAAATTCTTCGACAACATCATTAAACAGGTTCGGCCAGAATCTGAATACTATAGGGTCGGCTTCTACGGCAAAGGTTTTCCATCTTCAGTGAGGAACAAAGCGTTCGTGTATCGAGGTCAGGAGTACGAGAAACTCGGCTCGTTCAACCAGAGACTAAAAGCACAGTTCCCGGATGGTCTGATGATGGACAAAAACACGCCTCCAGAGGATGATATACTGGAATCTAACAAACAATATCTGCAGTGTTGTCGAGTGCTTCCCATCTCGGAACACGAGGAACGTTTTTCTGGGAAAGCAGTTGATGATAAAATTGCAGGTTATTACCGTGTAAATGATGTCAGACGCTTTACAAACTCACGACCTTTGCGCCCGGGACTTGAGGATTTTGGGAACTTGTGGTTGGAAAGAACGACCTACACAATCTGCTCGCCTCTTCCTGGAATTCTCAGATGGTTTCAAATCACCTCTTCTGAAAGCGTTGAAATCAGTCCTCTGCTGAACGCCGTTGAAACCGTTGAGTCAAAGAACAAGGAGCTGAATAGGATCATCACTAATCTGCTGTCAGACAAGACTCAGAGTATTAACCCTCTGGGTATGATCCTCAATGGTATCATTGACGCTGCTGTCATGGGAGGGATAGCCAAGTATGAAGAGGCATTTTTTGGCCCAGAATACCTGAAGAAGAATCCCAAAGATAAGCAGCTTATTGACCAGCTAAAACGCGCCATAGACGATCAGGTCAAAATATCGGAGAGGGGACTGGAACTTCATGATGAGTTAGTAACAGAAAACTTGCGTCCATTTCATAACAAGATGGAGACTTGTTTCGCTGACATGAAGGCTCGAGTCACAGGGGAGGAGAGAAGGTCTGCCAGGCCTAAAGATCTACAGATTCCCTTGCCGCCAATACCTGTGGCCCAGACACTACGGCTCAAAAAGGACGGGAGAAAGCAAAGCTTACCCTCAGACGTGGGCAGAGAAAGTATTCCGGTGGCGATTGCAAAACAAAGGCGTCAAAGCGAGCTTCCTGCTACACGTCAAAGCTTGTGGTATGACGATCAACCAGCAAATAAGATTTCTGGATCAAAGTCCCTTGAAGCTCTTTCAGAAATCGATGAATTTGCGCCACCGGTTCCAAAGAAGGGTTCCAGGTCGGACCTTGCATCTGGGCAATCCCCTGACTCAGTACGACGGAGGACTGTTCCTCGTGGATCACTTCACCAAAGGAGCTCCTCACCAGCGGGCATGCTGAGAATGGCCACCTCGCCACAAAACAATAGAGAAACGTCCCCTGCTATTCCTCCCAAACGTAAGAGTATCTTGGTGCCCAATCCCACAGACAACTCAGCGCCTTCGCCCCCACCCCTCCCTACACGTACCTCGGGTGATCTACCGACAAATTTTGTGGTAAACGGAGCAGAGATTGGAAACGAGGCCAAGGTAGCCCCGCCTGCAAGCGAAGACAATCTTCCAGCCTTACCTCCCAAAAAATCTGTGTCCCGGATGTCTGTTGAAGTGAATGAACCCCCTGTTCCAGAAAAACCAAAGCGCCCAGTTACGCTGACGTCACCTGTAGATGATTTAGAACCTCCACCTATGTTGCCAGAGAAACGAAAGAGTTACGCCAGCACCCTTAGTCTAACCTCCAGTCGAGCGTCATCAGTGTTCTCTGATTCAGTTCCAGATTTCACGTGTCCTCTGTCTCCTTTGTTCCCGTCAAACCCTACTGATAGACTGGGTAATGTAACACCGCAACCCTTCGCTCGGGATTCCCGCGGGTCATCATTGCCGTCAGGGTCTTCAATTTCAACTATATCCCCGACGACTCCCCGGCCGGGGGGCTTCACATCCCAGGGGTCAAGTTCCAGCGGACCAAATGGCTATAGTTACGTAACACCTCCCACGTCTCCACGAGTGCCGTATGCGTATGTATCGTCGCCCAATGCATCAGTAGCTAGCTGGGTGTCGGAAAGCACAAATTATTTTTCAGCGTCTTCCTCGTTTGACAGTGATATTCTGTCCCCGGGGAGTCCGCCGAAGCGGGGATTTAACACGGGGACGCTGCCGCCGTTATCAACCCCAATGAATGAAGATCTGTTTGCAGGAACGTCGCCGACGAAGAATGACTCCACTCCACTGCTTATTCCGTTTAAAGAGAAGCAGAATTTTTCGACGATTGAAAGAGTTGAAAATTGGTCGTTTACCGAAACCACGTCAACAGTGACGTCATCAACCACAGTTGGGTCACGTGACGAACAAGCGAAGCCTCGTACCCCAGTTCCCGCTCCTCGGAGAAACACTTTAGCCTCCTCAAGTCGAGCCGCGTTATCTAGATCGTGCTCAGACGCGTCCGATGGGCGGTCAAACATTCACGGTTTTGGACAAGGGGTGACTCCACCCGAGGTTAAACCCCGAACATCCCTTTATTTCCCAACAGATCACAACATGAAGTCTCCCCCGCCTAAGCCGCCGAGACCTTCACAGTCTGTTAACAAACTACCTCCGCCAATGCCAAAGCCTTACGCCTCCAAGTCGGCCGAAAGTTCTCCGGCAACTCAACGGAAAGCGCTCAATGCGGATATGCACGACATTCCGCCTTCAGAAGGAAATGGAACATAA

Transcript

OS493_012432-T1

Protein

OS493_012432-T1

MAAWKATSDAKYGVVVYNFDGNITYGLRLTIGETVHILEECAGWYRGCTLRNKAVKGIFPATYVRIKDCSVENAGTSGESVVPKEDATVKELTLILREWSVIWKDCYRTQKVRLFEALKTIMWDLVECRQKLLSGTLTQDQMDDIKKKTITKIDWGNSKMGLDLIPRVDGEVVDADSTSVVELYKVHVSSAEANLQVSGRGNFKKRASRGISTVIHHAYLNMTRFGCSIDEKCQLFFSIYDAREGRFISERFLVAISKSDSTQKVNQPQKIDNSTCVFTDLGSKDISAEAYLVAHIVRVGRMLPDGSSKKVSTASYRRPFGCAVLDIVDVLTGKEELLEEKEFHMPIFTCSDSDFWTVHDSIIKKQTSKYSVPSSNSGIHVSLRVLHGDLDKIQSENPLLLPKGIPIVRKLGFPDVIMPGDIRNDIYVTMERGEFEKGSGKTTSKNVEVSMCVIGPKGKVIEDCVFLGAGGSSLTEYQSIIFYHNSSPKWNETIKIQLPFDKFLGSHLRFGFRHLSKFEEKEKSDKTFGFSFESLMRKDGTTVPDGTHDLCVYKYDENCFYDSMTYLHMPSSLSQMANHANSGSDRLVRNSKDTFFIRTIVCSTKLTQNVDLVGLLRWRSQKRQVPSVLTSLLKIDGEEIVKFLQDIFDALFAILNESAEQYGNLVFQALVFIICILSNEKYQHFQGVLTTYIDKHFSAAMAHKKLISCLRQVLNYTGENDKMENLKNTMMALECLFKFIIQSRMLLISMHRGRDVTSQDLFRQDLWSVFTDLNELMSSRLPDVTVQSLAMQHFAGIYQDTLKVFSIEELSMIAKQFLLSAARDQKALTSSKLQFIDATVKSELFVHKESRTILMPVLVTSIQQQLMQKQDMRRCAETLGSILTSLTTGTAKGPIEEDVYLIVRTLLQPVFQTVMTVDRTSELARHFLAVLTNLLWIMTDDHYQQYLKEFRSNKELKDFLVNVFVVFIEIVKRGIFLRDWIVIIVLGNSVILRAIQNFSQALVDNFSEDNFDYQLWNSYFNLSVSFLTQSHLQLENFTEVKKNKIIDRYGDMRQVMGFEIVNMWQTLGSFQRHFMLTMVCPFLEMTLVPETELRKATLPIFFDMVECELKSKGMATMVETKIVNELDRLVSVDRKGDKEYKKLFKQILTEKFEDGLLFCEEGLAFVSRVTDLLELLLDYRRVSAEDDREQKMSCLVHLLEFYEKIGREDMYIRCINRLCDLHIAAENFTEAGITFLKHAELLKWPETLDDSPDSLKDFQLKEKLYLDAIEFLDKGKTWEKAIELCKELTEQYESPLFDFIKLGDILKKQAKFFDNIIKQVRPESEYYRVGFYGKGFPSSVRNKAFVYRGQEYEKLGSFNQRLKAQFPDGLMMDKNTPPEDDILESNKQYLQCCRVLPISEHEERFSGKAVDDKIAGYYRVNDVRRFTNSRPLRPGLEDFGNLWLERTTYTICSPLPGILRWFQITSSESVEISPLLNAVETVESKNKELNRIITNLLSDKTQSINPLGMILNGIIDAAVMGGIAKYEEAFFGPEYLKKNPKDKQLIDQLKRAIDDQVKISERGLELHDELVTENLRPFHNKMETCFADMKARVTGEERRSARPKDLQIPLPPIPVAQTLRLKKDGRKQSLPSDVGRESIPVAIAKQRRQSELPATRQSLWYDDQPANKISGSKSLEALSEIDEFAPPVPKKGSRSDLASGQSPDSVRRRTVPRGSLHQRSSSPAGMLRMATSPQNNRETSPAIPPKRKSILVPNPTDNSAPSPPPLPTRTSGDLPTNFVVNGAEIGNEAKVAPPASEDNLPALPPKKSVSRMSVEVNEPPVPEKPKRPVTLTSPVDDLEPPPMLPEKRKSYASTLSLTSSRASSVFSDSVPDFTCPLSPLFPSNPTDRLGNVTPQPFARDSRGSSLPSGSSISTISPTTPRPGGFTSQGSSSSGPNGYSYVTPPTSPRVPYAYVSSPNASVASWVSESTNYFSASSSFDSDILSPGSPPKRGFNTGTLPPLSTPMNEDLFAGTSPTKNDSTPLLIPFKEKQNFSTIERVENWSFTETTSTVTSSTTVGSRDEQAKPRTPVPAPRRNTLASSSRAALSRSCSDASDGRSNIHGFGQGVTPPEVKPRTSLYFPTDHNMKSPPPKPPRPSQSVNKLPPPMPKPYASKSAESSPATQRKALNADMHDIPPSEGNGT

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8CIQ7	Dedicator of cytokinesis protein 3 OS=Mus musculus OX=10090 GN=Dock3 PE=1 SV=1
Q8IZD9	Dedicator of cytokinesis protein 3 OS=Homo sapiens OX=9606 GN=DOCK3 PE=1 SV=1
Q14185	Dedicator of cytokinesis protein 1 OS=Homo sapiens OX=9606 GN=DOCK1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001155 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14429 all species →	DOCK-C2	C2 domain in Dock180 and Zizimin proteins	Domain	Interproscan
PF20422 all species →	DHR-2_Lobe_B	DHR-2, Lobe B	Domain	Interproscan
PF07653 all species →	SH3_2	Variant SH3 domain	Domain	Interproscan
PF06920 all species →	DHR-2_Lobe_A	DHR-2, Lobe A	Repeat	Interproscan
PF20421 all species →	DHR-2_Lobe_C	DHR-2, Lobe C	Repeat	Interproscan
PF16172 all species →	DOCK_N	DOCK N-terminus	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR042455 all species →	Homologous_superfamily	Dedicator of cytokinesis, N-terminal, subdomain 1	Interproscan
IPR043161 all species →	Homologous_superfamily	Dedicator of cytokinesis, C-terminal, lobe A	Interproscan
IPR027007 all species →	Domain	C2 DOCK-type domain	Interproscan
IPR046770 all species →	Domain	DOCKER, Lobe B	Interproscan
IPR026791 all species →	Family	Dedicator of cytokinesis	Interproscan
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR043162 all species →	Homologous_superfamily	Dedicator of cytokinesis, C-terminal, lobe C	Interproscan
IPR046769 all species →	Domain	DOCKER, Lobe A	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR027357 all species →	Domain	DOCKER domain	Interproscan
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR046773 all species →	Domain	DOCKER, Lobe C	Interproscan
IPR032376 all species →	Domain	Dedicator of cytokinesis, N-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45653 all species →	DEDICATOR OF CYTOKINESIS	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005085 all species →	Molecular Function	guanyl-nucleotide exchange factor activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007264 all species →	Biological Process	small GTPase-mediated signal transduction	Interproscan
GO:0031267 all species →	Molecular Function	small GTPase binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_012432-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012432-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

34.7Max TPM

17.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	16.46	23.62
polyp at pH7 6	18	18	16.87	22.57
coral polyp · control treatment	16	16	22.00	34.73
coral polyp · oil and dispersant treatment	16	16	20.39	32.40
coral polyp · oil treatment	16	16	19.35	27.05
coral polyp · dispersant treatment	16	16	13.45	22.32
Polyp	10	10	9.44	17.74

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.62
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.71
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.30
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.96
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.60
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.32
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.94
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.40
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.85
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.47
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.13
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.00
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.62
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.60
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.91
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.14
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.75
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.92
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.57
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.56
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.16
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.88
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.13
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.08
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.90
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.77
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.06
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.72
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.41
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.14
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.28
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.84
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.69
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.58
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.54
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.29
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.73
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.41
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.91
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.94
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.04
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.73
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.40
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.67
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.04
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.25
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.88
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.53
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.16
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.00
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.24
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.02
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.40
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.10
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.58
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.02
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.77
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.25
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.71
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.35
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.90
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.76
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.12
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.85
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.85
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.22
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.31
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.12
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.05
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.78
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.04
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.17
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.69
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.89
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.69
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.47
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.57
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.79
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.40
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.10
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.75
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.71
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.63
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.92
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.32
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.89
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.59
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.88
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.76
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.71
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.36
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.71
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.54
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.16
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.34
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.13
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.04
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.44
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.81
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.58
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	17.74
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.87
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	12.57
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	11.52
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.25
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	9.55
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.16
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.94
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.58
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.26

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.