Gene detail

Detailed information of OS493_012494-T1 in Lophelia pertusa

Genomic Location: scaffold_32:3120573...3134657
NR annotation: KAJ7386148.1, hypothetical protein OS493_012494 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012494-T1

ATGATGAGAATGGATCTGGATAATAACTCTATCAAAACTCTGGAACCAGGAACCTTTAAAAGTTTTAGAAAATCAAGAATATTTAATTACCTATCGATAACTGGAAATAAAATCGAGATTCTCAAGAACAAAACATTCGATGGTCTAACCTATCTATATAAACTTTATTTGGAAAACAACAACATCCACGTCATAGAGGCCAGTGCTTTTTACAAAATGACCAGAATCTTCGTCATGAATTTGAATGGAAACCGACTGAGAAACATCACCAATGGGACATTCTACTTTAGAAGAACACTTCAATATCTGACATTATCTGATAACAACATATCAAGTCTTCCGGAGGGGGTGTTTGCCAAACTGAAATACTTAAAGACCTTGAATCTCACCAATAACCCGTTGCAGCACATCCATGTAGGGCTTTTAAGAGGCTTATATCGCCTTACTGAGCTACAAATGGAACATTGTGGAATAAAAGAAATCGAACCAAAGTCATTTGCGTCCTCAAGGCCACTCGATACATTAAACTTGGCGAGAAACTCTCTGAGAAGAATCAACAATACCTTCTTCAGCGATCTTCGCTACTTGTCATATTTGTTCTTGGACAACAATGAGATTGAAGTCATGGAGAACAAATCTTTCAAAAGTAACAGCTTCATGAGGCGCCTATTCCTTCATGGAAACAAACTGACCAAAATTTATGCAGGTGTCTTTGATTCTATGTGGAGATTAATGTTTTTAACACTTAGCAACAACAAAATCTCTGATATTGAACCAGGAGCATTTCGGCGACAAAGGACGATGCAAACTTTATTTTTACAATACAATCGCCTAGAGAGAATAAAGAAAGAAGACTTTCAATATCTTTTTGATCTAGAAAGGCTGTACTTGTTTGACAACAGGATATCTTCGATTGAGGACGGATCATTTCCGCACCGGCAATTGGAACAGTTGCTTTTGTACAAAAACACCGCCCTGTCGTCAATAAATATCTTCGCTGATGGAGTTCGTACACCAAATGTGACGGTTTATATGTATCCCGAGAATCTCCCGTCAGTTCAAGTTGAAACCAGAACACATGCAGACATACTTCACAAAAACGGATTCCGATGCGACTGTTCAGTTAGGTGCGTTTGCAAAATGTGTCCCAGAGGGATGTATTCAAAAGGAGATGGTGTATCCGTAGGATGTTTAACGTGTCCAGCAGGTGGCTTTTTCCAAGATTCAGTTGCAGCAGTTGGTGTAACTGCGGAGGGCCACGGATGTCAGCATTGCCCAAATGGAACGTTTGTACATCCAATAAACGCACCGGGAAAGGCATCGTGGGAATGCAAGGCATGTCCAGAAGGAACTAACACAACAATGTTGGCTGGATACAGGGCATGCTGGTGTTTAAAGAACTATTTCCGCATGGATCGATTTGGTCCGTGTACAGCCTGTCCTAGTCAGGGTGTCGAATGTTTTAACGACACATTACTTTTGTCACGTGGGTTTTACTGGTCATGGTTGGGTAACGGAAGAAACTCCGACAACAAAAACGTTTACAAACTCTTGAACGTGAATTTGGCGATAGAAAGCGACAGTTACAACAATAAAACAATGAAGTACGTTGGTAAAGTTCCAAAAGTCTACAAATGTCCTCGACAAGATTCCTGTCTCGGTGGAATTGACTCTGAATGCGCCGAGGGCTATGCTGGACCTCTGTGTGCCAATTGCCAATCAGGATTCTATAAACGGGTGATCGCGTGCCACAAGTGCCCTTCAAAGAAGCTCATTTACATACAGCTTGGAGTACTGGCTTTCATAATCCTTGTAATCATCTTAGTTATTGTTAAGAGCGAGAAGTCATCGACGCCAGGAAGACGCACAGTAGCCGACATCTTTCTTGCTCACGTGAAGATTATCATCGGGTTTTATCAGGTTTTGGCAGGTTTACTTCAAGCGTTTTCATATATTGAATGGCCGTCGGAAATTTCTATTCTTGAGAGCTACATCAGATTTGTCCAGCTTAACTTCTTACAGATCGTTTCTCCAAGTTGTGTGGAAGAAAGCTTCCAAGTGAATGCTTATAGCCACTTCGCTTTCACATTGGCCGGAAATGTGTTGAGTATCGCTGTTCCATTGTTTTGTTACCTTGCCAGGGCCATGTGGATGAAGATAAGGGGACAGCAAAGCGACGACCTCCTGGACGTGAAAAAGTCTTGTCTTAAAATCACAATGTTTCTTTTATTTGTCGCATATCCATCTACTTGTGTCAACATTTTTAAGATTCTTCCTCTCTCTTGCAATGAATTATGTCCTTTTGAAGGTGCTTCTGACTGTCCATCCTTCTTAAGAGCTGACTACTCGATTCGGTGCGACACAGATACGCATAGAAAATACTCATGGGCTGCATACGCCTCTTTATCATATGTCGTTGGGTTTCCTATTTTTCTGGCATACATTGTGTGGAAATCCCATCTTCAATCCCAGAGATCGAACAAACTATCCATAACAGATCTAGATGAAAGCTACCACATGAAAGCGATGGCGTTTGCCATTTTGTTCCTACACGAGAACTATTCACCAGGTTGCTGGTACTGGGAAAGTATCGAAATGGCGCGAAAAGTGATACTGTCGGCTGGTGTCATCTTTGTCGGTTCCGAAAGCCGCACGCAGGTCGGAATCGCTGCCATGGTATCTGCTGGGTTTGCAATGCTTCACGGCCGATTTAGACCTATTACAGACAGATTCGAGGATTATTTGCAAATGATGTCGCTTTTGGTGACTTCATTCAACCTTGCGATAGGCGTGTTGCTGAAGATGCCTTCCGATAAAGTAACTGGAAGTGTGGACCAAACTCTTGACAAAGTGGGCCTTGGCATATTACTGTTGGTGACAAATGCATTGGTAATAAGTGTTGTGTTAGCTCGGTATTTGTTCGCCTTTTTACGGCTTGCTATGAAATTTCGCAACAACCCTCGTTTCAGCTGGAGTTGCTTGTTTCAGTTGATGGCCACAGAAGAGGAAGAGCAAGCAGATGACAATGATGTTAATTTCAAGAGAGCATCTATTAAACCTGTAGCAACAGGATATGACGTCGATATGCCTACTACCACTGCTGCTGTCGTGAACGAGTGCTTCGATTTGGATTTTGAAAACAAAATTGATGATCAGCTGCCTCCTTCAGCGCGGAGAATGGAGAACTTTACTGTAAATACGTTAACATGA

Transcript

OS493_012494-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000105 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13855 all species →	LRR_8	Leucine rich repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR051432 all species →	Family	Voltage and calcium-activated potassium channel auxiliary protein	Interproscan
IPR003591 all species →	Repeat	Leucine-rich repeat, typical subtype	Interproscan
IPR009030 all species →	Homologous_superfamily	Growth factor receptor cysteine-rich domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46473 all species →	GH08155P	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_012494-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012494-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

27.9Max TPM

7.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.75	19.10
polyp at pH7 6	18	18	5.22	8.29
coral polyp · control treatment	16	16	9.55	24.85
coral polyp · oil and dispersant treatment	16	16	6.58	17.73
coral polyp · oil treatment	16	16	7.41	14.15
coral polyp · dispersant treatment	16	16	5.80	18.66
Polyp	10	10	9.99	27.85

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.10
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.97
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.29
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.76
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.35
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.09
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.94
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.80
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.34
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.79
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.18
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.96
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.58
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.53
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.96
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.84
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.01
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.96
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.29
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.78
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.63
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.55
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.20
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.64
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.72
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.97
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.53
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.33
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.03
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.72
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.60
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.15
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.06
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.95
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.81
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.85
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.92
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.84
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.70
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.07
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.45
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.66
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.57
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.36
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.92
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.87
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.74
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.22
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.46
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.53
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.59
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.73
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.05
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.75
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.67
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.15
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.11
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.89
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.19
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.56
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.05
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.78
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.76
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.08
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.83
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.26
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.51
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.15
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.05
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.58
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.40
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.83
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.55
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.82
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.81
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.75
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.07
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.00
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.21
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.16
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.46
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.04
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.74
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.66
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.12
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.94
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.66
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.73
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.31
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.14
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.41
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.67
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.55
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.14
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.23
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.89
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.63
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.19
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.47
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	27.85
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	18.96
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.44
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.39
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	9.76
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.57
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.63
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.09
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.71
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.47

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.