Gene detail

Detailed information of OS493_012562-T1 in Lophelia pertusa

Genomic Location: scaffold_33:545870...573658
NR annotation: KAJ7379815.1, hypothetical protein OS493_012562 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012562-T1

ATGAAAGATTCGATTATCGTGTATATTTGTAAGCTTCCAGATACTGCCAAGCCAAGCCGTTTGTACATTAAAGGAGACCATGTCACTTGGATCAGACCAACAACATTGGACGAGTTGTTAGAGCTCAAGATGAAATATCCCCAAGCTAAACTTGTGATTGGTAACACTGAAATAGGAATTGAGATGAAGTTCAAGAATCAGAATTATCCAATCCTGATAGCTCCAACTCACATCCCAGAGTTGAACGCTGTGGAAACACACAGCAGACGGCATCAAGCCATTGGTGGAAATATCATGACTGCCAGTCCAATATCAGACCTGAATCCAGTGTTTATGGCGGCAAGGATACAGAAAAACGATTTGGGAGCAAGTGAAGTCTTGATTAACATCCTCATTCCATTCACGAAGAAGCATGAACATGTATTCGCCTTCAAACAAGCTCGTCGACGTGAAGACGATATTGCCATAGTGAATACAGCCATGAGAGTGTTGTTGGAAAAGGAAACAAATTCCAGTTCGTGGAAAATCATGGATTGCAGTTTCAGTTTCGGAGGCTTGGCTCCTACAACAGTCATGGCTAAAAGGAACGAGAGCATAGTTCAAGAGGCTTGTCAGTTGTTAGCTGAAGATCTGCCGCTTGCACCCGGAGCACCAGGAGGTCAGGTGGAATACAGGAGATCACTTGCTACAAGCTTCTTCTTCAAGTTCTACTTGAATGTTTCTCAATCTCTCAGCAAAAATGAGTTCCTGGAGATTACTACCAAAGGCTATGAGAGTGGAACGAAGCATTTCCACAGAGATGCAACCCACAGCATACAGACCTTTCAGGAAGTCCCTAATGATCAGACAGTAGAGGATGTTGTTGGGAGGCCTGTGGCTCACTTAGCAGCAGAGAAACACGCCACAGGAGAGGCAATCTACTGTGATGACATTCCTAAGTATGCAGGAGAACTATATTTGGGCATTGTTTTCAGCACACGTGCTCATGCCAATATCATAGCTGTGGATCCTAGTGAGGCGTTGTGTCTCCCAGGGGTAAAAGCCTACGTTAGCGCAGACGATGTCCCTGGAGAAAACTCCACGGGAAGTGAAGTGTACGATGAAGAGGTTTATGCAACAGACACGGTGACATGCGTGGGACAAGAAGCCATAGCAGCTGGGTCGTTCTACGAGTGTGAACCGTGCATTCATGAGAAAGGAGACCTGGAAACTGGTTTTGCTGAATCTGATCACGTGTTGGAAGGAGAGATGAGAATGGAGGACAGGCGGCGGCTTTGGTGCAAACAGACACGGAACTGTTTCCTGACAAATGCTGTGGCAGTGGCTGCTGCTAAGACTGGTATGCCTGTGCGATGTATGCTTGATCGAGATGAAGACATGAAGAGCACTGGAATGCGTAGTCCTTTCTTAGCCAAGTACAAGGTAATGGGAAGAGCTTTGTTTCACATGGAAAACTGTTACCTCATTCCAAACATTCGTGGTGTTGGTTACTTGTGCAAAACAAATATTCCTTCAACTACAGGCTTCAGAGGGTTTGGTGTTCCGCAGAGCATTTGTTTTGCTGAATCGTGGATCTCTGACATTGCTCTCACCTGTGGCATCTCCCAAAGACAGGTTCGAGAAGTGAATTTTTACAAAGAAGGAGACCTAACTCATTTCAACCAAAAACTGACCAATTGTTATCTTCAGCGAGTATGGAATGAGCTGATTGAGAAATGTGATTATGAGAAACGAAGGGAACTCGTCCACGCCTTCAACAGGGAAAATCGTTGGAGGAAACGTGGAATTGCTCTCACCCCCGCTATGCTTGGTTTAGGTTTTGGTGTACCCGCCCTAGACCAGGCTGGAGCTCTGGTTCATGTGTACACAGACGGATCAGTTATTTTGACTCATGGTGGAACAGAAATGGGGCAAGGACTGCACACCAAAATGGTGCAGGTAGCAGCTAGGAGTTTAGGTATTCCTGTGTCCAAGATCCTAATCAGTGAAACAAGCACCAACACGGTTCCTAACACCTCCCCTACTGCGGCGTCGGCGTCAACTGATCTCAACGGCATGGCGGTTAAAATTGCTTGTGAGCAAATACTGGAGCGGTTAAAGCCATATCAAATGGCCAATCCAAAAGGAAAGTGGGAAGACTGGGTACACTCGGCCTATTTTGACCGTGTTAACCTTTCTGCAAATGGATTTTACAAGAGAAGCAACAAACCTCTTGCAGGGTTCCTGATCTCAGTTACGACTGGAAGACCAATACAACAGGGCGGATGTATTATTACTTTCACTTATGGTGCTGCCTGCTCTGAAGTGGAAATCGATTGCCTCACAGGAGATCATCAAGTTCTTCGCACAGATATTGTAATGGATGTTGGTACCAGTCTCAACCCGGCTATCGACATTGGTCAGATTGAAGGTGGTTTTGTACAAGGACTGGGTCTATATACGCTGGAAGAAATGCGATGCTCTCAGACCGGCTCTCTATGGACGACGGGGCCTGGGGCCTACAAGATTCCAGGATTTGCAGACATACCAGTGGAATTCAATGTTCATCTTCTGCGCAGTGCACCGAACGAAAAAACTATCTACTCTTCCAAGGGTGTTGGAGAACCTCCTGTGTTGCTTTCTGTATCAGTCCTTTTCGCCATTAAAGATGCTATTACGTATGCTAGACGTGAATCAGGTATTGAAGGGATCTTCAGACTGGACAGTCCAGCTACCAGTGAGCGTATTAGAATGGCTTGTGTTGACAAGTTCACTGAACAATTTACCTCTGTGGCGGATCCGAGTGTGAAAGACTTTAACGTGTACCCTTAA

Transcript

OS493_012562-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P47990	Xanthine dehydrogenase/oxidase OS=Gallus gallus OX=9031 GN=XDH PE=1 SV=1
P47989	Xanthine dehydrogenase/oxidase OS=Homo sapiens OX=9606 GN=XDH PE=1 SV=4
P80457	Xanthine dehydrogenase/oxidase OS=Bos taurus OX=9913 GN=XDH PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001294 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03450 all species →	CO_deh_flav_C	CO dehydrogenase flavoprotein C-terminal domain	Domain	Interproscan
PF00941 all species →	FAD_binding_5	FAD binding domain in molybdopterin dehydrogenase	Family	Interproscan
PF01315 all species →	Ald_Xan_dh_C	Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain	Domain	Interproscan
PF20256 all species →	MoCoBD_2	Molybdopterin cofactor-binding domain	Domain	Interproscan
PF02738 all species →	MoCoBD_1	Molybdopterin cofactor-binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036318 all species →	Homologous_superfamily	FAD-binding, type PCMH-like superfamily	Interproscan
IPR005107 all species →	Domain	CO dehydrogenase flavoprotein, C-terminal	Interproscan
IPR037165 all species →	Homologous_superfamily	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding domain superfamily	Interproscan
IPR016208 all species →	Family	Aldehyde oxidase/xanthine dehydrogenase-like	Interproscan
IPR000674 all species →	Domain	Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead	Interproscan
IPR016167 all species →	Homologous_superfamily	FAD-binding, type PCMH, subdomain 1	Interproscan
IPR002346 all species →	Domain	Molybdopterin dehydrogenase, FAD-binding	Interproscan
IPR036856 all species →	Homologous_superfamily	Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead superfamily	Interproscan
IPR046867 all species →	Domain	Aldehyde oxidase/xanthine dehydrogenase, second molybdopterin binding domain	Interproscan
IPR008274 all species →	Domain	Aldehyde oxidase/xanthine dehydrogenase, first molybdopterin binding domain	Interproscan
IPR036683 all species →	Homologous_superfamily	CO dehydrogenase flavoprotein, C-terminal domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11908 all species →	XANTHINE DEHYDROGENASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0050660 all species →	Molecular Function	flavin adenine dinucleotide binding	Interproscan
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0005506 all species →	Molecular Function	iron ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_012562-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012562-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

102TPM > 0

7Conditions

6.2Max TPM

1.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.51	5.86
polyp at pH7 6	18	16	3.03	5.56
coral polyp · control treatment	16	16	1.24	2.23
coral polyp · oil and dispersant treatment	16	15	1.26	3.30
coral polyp · oil treatment	16	16	1.81	5.60
coral polyp · dispersant treatment	16	15	0.91	3.02
Polyp	10	6	1.31	6.24

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.86
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.70
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.26
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.19
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.72
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.49
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.98
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.89
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.74
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.29
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.86
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.79
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.60
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.29
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.97
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.68
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.52
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.30
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.56
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.53
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.71
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.92
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.71
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.69
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.55
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.47
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.44
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.20
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.78
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.62
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.48
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.08
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.95
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.87
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.23
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.98
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.96
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.92
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.91
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.89
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.60
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.11
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.89
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.87
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.82
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.76
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.68
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.52
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.42
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.28
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.30
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.12
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.71
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.69
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.57
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.52
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.42
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.41
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.37
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.94
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.92
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.81
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.64
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.40
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.29
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.60
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.65
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.82
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.58
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.40
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.85
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.81
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.55
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.52
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.37
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.17
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.01
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.47
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.42
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.41
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.39
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.02
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.00
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.54
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.37
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.26
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.00
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.89
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.74
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.64
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.56
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.53
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.37
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.33
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.20
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.16
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.24
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.78
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.78
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.50
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.54
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.28
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.