Gene detail

Detailed information of OS493_012608-T1 in Lophelia pertusa

Genomic Location: scaffold_33:1010944...1049311
NR annotation: KAJ7379856.1, hypothetical protein OS493_012608 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012608-T1

ATGACATTCCTAAGTATGCAGGGAGAACTATATTTGGGCATTGTTTTCAGCACACGTGCCCATGCCAATATCATAGCTGTGGATCCGAGCGAGGCGTTATGTCTCCGAGGGGTAAAAACATACGTTAGCGCAGATGATGTCCCAGGAGAAAACTCCACGGGACGTGGTTTGCACGATGAAGAGGTTTATGCAACAGACAAGGTGACATGCGTGGGGCAAGAAGCCATAGCAGCTGGGTCGTTCTACGAGTGTGAACCGTGCATTCAGAAAGGAGACCTGGAAACTGGTTTTGCTGAATCCGATCACGTGTTGGAAGGAGAGATGAGAATTGGAGGACAGGAACACTTCTATTTAGAGACACAAGCTACAGTCGCTGTTCCTAAAGGAGAAGATGGTGAAATGGAACTTTTTGTTTCCACTCAAAATCCAACATTGACTCAGAAACTTGTCGCAAGAACCCTTGGAGTTCCACACAACCGAATTGTAGTGCGCACTAAGCGACTGGGTGGTGGCTTTGGTGGCAAAGAGACACGGAACTGTATCCTGACAAATGCCGTGGCAGTGGCTGCTGCTAAGACTGGTAGGCCTGTGCGATGCATGCTTGATCGAGATGAAGACATGAAGAGCACTGGAATGCGTAGTCCTTACTTGGCCAAGTACAAGATTGGTTTTACGTTGAATGGAAAGATCAAAGCCTTCGACATTAAACTGTACAGCAACGCTGGAAACTCAATGGATGCATCAGAACATGTAATGGAAAGATCTTTGTTTCACATGGAAAACTGTTACCTCATTCCAAACATTCGTGGTGTTGGTTACTTGTGTAAAACAAATATTCCTTCAACTACAGGCTTCAGAGGGTTGGTGTTCCGCAGAGCATTTGTTTTTGCTGAATCGTGGATCTCTGACATTGCTATCACTTGTGGCATCTCCCAAAGACAGCGAGTATGGAATGAGCTGGTTGAGAAATGTGATTATGAGAAACGAAGGGAACTCGTCCACTCCTTCAACAGGGAGAATCGTTGGAGGAAACGTGGAATTGCTCTCATCCCCGCTATGCTTGGGATAGGTTTTAGTTTTGCCACCAAAAACCAGGCTGGAGCTCTAGTTCATGTGTACACAGACGGATCAGTTCTTTTGACTCATGGTGGAACAGAAATGGGGCAAGGACTGCACACCAAAATGGTGCAGGTAGCGGCTAGGAGTTTAGGTATTCCTGTGTCCAAGATTCTAATCAGTGAAACAAGCACCAACACGGTTCCTAACACCTCCGCTACTGCGGCTTCGGCGTCATCTGATCTCAACGGCATGGCGGTTAAAATAGCTTGTGAGCAAATACTGGAGCGGTTAAAACCATATCAAATGGCCAATCCTAAAGGAAAGTGGGAAGACTGGGTACACTCGGCCTATTTTGACCGTGTTAACCTTTCTGCGAATGGATTTTACAAGGTTCCTGATCTCACTTACGACTGGAAGACCAATACAGGGCGGATGTATAATTACTTCACTTATGGTGCTGCCTGCTCTGAAGTGGAAATCGATTGTCTCACAGGAGATCATCAAGTTCTTCGGACAGATATTGTAATGGATGTTGGTACCAGCCTCAACCCAGCTATCGACATTGGCCAGATTGAAGGTGGCTTTGTACAAGGACTGGGTCTATATACGCTGGAAGAAATGCGATGCTCTCAGACCGGCACTCTATGGACGATGGGGCCTGGGGCGTACAAGATTCCCGGATTTGCAGACATACCAGTGGAATTCAATGTCCATCTGCTGCGCAGTGCACCGAACGAAAAAGCTATCTACTCTTCCAAGGGTGTTGGAGAACCTCCTCTGTTGCTCTCTGTGTCAGTCCTTTTCGCCATTAAAGATGCTATTACGTACGCTAGGCGTGAATCAGGTATTGAAGGGATCTTCAGACTGGACAGTCCAGCTACCAGTGAGCGTATTAGAATGGCTTGTGTTGACAAGTTCACTGAACAATTTACCTCCGTGGCGGATCCGAGTGTGAAAGACTTTAACGTGTACCCTTAA

Transcript

OS493_012608-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P47990	Xanthine dehydrogenase/oxidase OS=Gallus gallus OX=9031 GN=XDH PE=1 SV=1
P47989	Xanthine dehydrogenase/oxidase OS=Homo sapiens OX=9606 GN=XDH PE=1 SV=4
Q9MYW6	Xanthine dehydrogenase/oxidase OS=Felis catus OX=9685 GN=XDH PE=2 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001294 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20256 all species →	MoCoBD_2	Molybdopterin cofactor-binding domain	Domain	Interproscan
PF01315 all species →	Ald_Xan_dh_C	Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain	Domain	Interproscan
PF02738 all species →	MoCoBD_1	Molybdopterin cofactor-binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR046867 all species →	Domain	Aldehyde oxidase/xanthine dehydrogenase, second molybdopterin binding domain	Interproscan
IPR036856 all species →	Homologous_superfamily	Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead superfamily	Interproscan
IPR000674 all species →	Domain	Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead	Interproscan
IPR016208 all species →	Family	Aldehyde oxidase/xanthine dehydrogenase-like	Interproscan
IPR008274 all species →	Domain	Aldehyde oxidase/xanthine dehydrogenase, first molybdopterin binding domain	Interproscan
IPR037165 all species →	Homologous_superfamily	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding domain superfamily	Interproscan
IPR022407 all species →	Binding_site	Oxidoreductase, molybdopterin binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11908 all species →	XANTHINE DEHYDROGENASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005506 all species →	Molecular Function	iron ion binding	Interproscan
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0043546 all species →	Molecular Function	molybdopterin cofactor binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_012608-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012608-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

78.2Max TPM

15.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	28.01	41.15
polyp at pH7 6	18	18	26.17	52.34
coral polyp · control treatment	16	16	7.88	22.32
coral polyp · oil and dispersant treatment	16	15	5.74	16.23
coral polyp · oil treatment	16	16	13.91	57.76
coral polyp · dispersant treatment	16	16	8.70	35.93
Polyp	10	10	18.27	78.23

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.15
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.47
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.53
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.22
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.35
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.91
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.70
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.82
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.16
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.63
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.22
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.70
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.40
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.36
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.07
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.94
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.63
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.91
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.34
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.52
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.21
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.97
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.70
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.95
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.99
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.81
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.64
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.60
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.14
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.69
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.35
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.63
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.92
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.35
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.22
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.99
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.32
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.68
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.47
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.58
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.67
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.61
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.06
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.64
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.87
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.75
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.66
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.12
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.83
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.92
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.19
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.66
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.23
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.97
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.02
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.73
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.14
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.28
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.99
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.95
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.49
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.14
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.01
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.40
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.63
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.46
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.36
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.76
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.71
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.13
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.37
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.97
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.21
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.47
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.77
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.73
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.17
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.96
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.86
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.66
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.63
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.28
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.83
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.93
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.64
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.17
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.27
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.13
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.75
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.43
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.35
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.89
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.34
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.10
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.08
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.57
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.37
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.72
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.44
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	78.23
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	35.90
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	25.53
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	19.13
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	11.33
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.09
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.56
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.40
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.32
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.26

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.