Gene detail

Detailed information of OS493_012733-T1 in Lophelia pertusa

Genomic Location: scaffold_33:2468867...2479273
NR annotation: KAJ7379971.1, hypothetical protein OS493_012733 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012733-T1

ATGGCTGCAATTGAGTTTCATGTGAATTCTACATTCAGCAACACCCAGCTGTCCAACACGCCTTCCCGGCCCATCCGCATCTGTGCCAGGAAAACTAACCATGGAATCATCTTCCGCTGCAGACGCCTCAGACAGAGACAGTGCGAACAGAAGATCGTTTCATGCACAGCTATCGAGAAGTTTTTTCAATCGCGGTCTTTGAGCTCTTCGTCTGTCGATGGCGGTTCACCGAGTCCGTCAAAAAATCGTCTTGGCACCCTGCCTGTGGAAGATCCTATAACACATGAGAACGTGGTCAACAGTAAAGTGCTGTTGCTGTACACGGGTGGAGCTCTAGGATGGAAAGTGGACCCGGATCTAGAAGGATTCCATCTTGATAAGAAAAATGTGTTAAAAGAACTCAAGAAACTTCCGATGATGCATGATGTGGAGTATGTGGACTACATCCAAAGCAATGTCCTGGATGATATTCCAGAGGAAGGGATTGGGTCAGACACAATAGTGATGCCTGTAAGCAAATATGGAAGACGTATATTTATTGACGTTTTTGAGATGAAAGAAAGCGACGTGGTCGTCCATTCCAAGGATCAAGACATTCAAGATTGGTCTAACATTGCTTTACGGATAAAGGAATGCTATGAGAATTATCATGGATTTGTTATTCTTCACGGTACAGATACTATGGCTTATCTTGCATCTGCGCTGTCGTTCATGTTTGAGAACCTTGGGAAATCAGTGATCTTTACTGGCTCGCAGTATTCTCTGAGTGATCATCTGAATGATGGAAGGCAAAATCTGCTAGGAGCTATAATGATTGCCGGCCATTATGTCATCCCAGAGGTGACATTATTCTTCCATGGAATACTTTATCGTGGGAATCGTGCCGTAAAAGTAGACGCACGCAGATTTGGTGCATTTGATTCTCCAAACTGTTCTCCTTTGGCCACAGTAGAAGCAGGAATTGAAGTTGAATGGGAGGAGCTTTTCTATGAACACCAAGCAACTAAATTCAAAGTGCACACCAAGATGAGTTCAAGAATAGGAGTGTTGAGAATTTTTCCAGGCATTACACCTGAAGCAATTCGTGCTTTCCTGGAGCCCCCTATAGAGGGAGTGGTCCTTGAAACGTACGGCAGTGGTAATGGTCCTGATTCACGAGAAGAGCTCCTGGAGGAGATACGAGCTGCGGCCAAGCGAGGAGTGATCATTATGAATTGCACTCAGTGCTTGTACGGTCATGTAGTCGACTCCTATGCTACAGGAAGGGTTTTGGTGGAAGCTGGTGTGATATCAGGAAATGACATGACCGTGGAGGCAGCACTGACAAAACTATCCTATGTGCTTGGACACGACAAGCTTACACTTGAAGAGAAGAAAGCGATGATGAAAACAAATCTACGTGGTGAGTTAACATTGTACAAAGATGAGAAAATGCAGCAGTTTTCCTTGCGTGACAATGAACTGATTGATGCTGTGGCTTCACATTTCAAAGTTGGATCAACTGAGGAAGTGAGGTTCATCAAGCAAGCGTTATTTCCGGTTTTGATGTGTCACGCTGCAGGAAGAGGTGACATTGATGCCATGGAAGAGCTGCGTCAACAGGGTGGCGTGTTAAACATTGCTCCGAGTCACGATGGCCGCACTCCACTTCATGTAGCCTGCCTGGAAGGTCAGCTGCAAGTCATTCGTCACCTCCTGGTGAAAGGCGCTTCACCGCACGTTATTGACAATCACGGGCAAACCCCGTTGCATGATGCTATTCGTAGCGCCAATGAGGAGGCTATTTTACTCCTCAGGGAGTTTGGAGCTCATTTAGGGCCCACCACCGTGGATACGGCCCTTGAAATATGCACCCTTGCTGCTGACGATAAGGTCGATAGATTGCGAGCTTGGCATTTGGCAGGAGTCGACTTCAATGTTGGTGATTACGACAGGAGAACAGCCTTGCATGTGGCTGTTTGTCGAAATAATATGAACACGGTCAAGTTTCTGTTGGACTGTGGTGTGGACTTAAACGTGCGCGATCTTTACGGCTTCACTCCGCGGAAAAACGCGGAGCTGTTTGAAAACAAAGAAATGGTGGAACTACTGCAATCTGCGATGGAAAAGAAGAAAATTAACGCAGTTGACGAGTGA

Transcript

OS493_012733-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9U518	L-asparaginase OS=Dirofilaria immitis OX=6287 PE=1 SV=1
O88202	60 kDa lysophospholipase OS=Rattus norvegicus OX=10116 GN=Aspg PE=1 SV=1
A0JNU3	60 kDa lysophospholipase OS=Mus musculus OX=10090 GN=Aspg PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001848 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00710 all species →	Asparaginase	Asparaginase, N-terminal	Domain	Interproscan
PF17763 all species →	Asparaginase_C	Glutaminase/Asparaginase C-terminal domain	Domain	Interproscan
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR041725 all species →	Family	Type I (cytosolic) L-asparaginase	Interproscan
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR006034 all species →	Family	Asparaginase/glutaminase-like	Interproscan
IPR027473 all species →	Homologous_superfamily	L-asparaginase, C-terminal	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR027475 all species →	Active_site	Asparaginase/glutaminase, active site 2	Interproscan
IPR036152 all species →	Homologous_superfamily	Asparaginase/glutaminase-like superfamily	Interproscan
IPR027474 all species →	Domain	L-asparaginase, N-terminal	Interproscan
IPR040919 all species →	Domain	Asparaginase/glutaminase, C-terminal	Interproscan
IPR006033 all species →	Family	Type I L-asparaginase family	Interproscan
IPR037152 all species →	Homologous_superfamily	L-asparaginase, N-terminal domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11707 all species →	L-ASPARAGINASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0004067 all species →	Molecular Function	asparaginase activity	Interproscan
GO:0006520 all species →	Biological Process	amino acid metabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13278	ASPG; 60kDa lysophospholipase	EC:3.1.1.5 EC:3.1.1.47 EC:3.5.1.1	Enzymes with EC numbers	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012733-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

28.9Max TPM

7.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.61	12.47
polyp at pH7 6	18	18	7.58	11.11
coral polyp · control treatment	16	16	10.40	28.88
coral polyp · oil and dispersant treatment	16	16	7.64	27.36
coral polyp · oil treatment	16	16	8.22	13.87
coral polyp · dispersant treatment	16	16	4.68	7.35
Polyp	10	9	4.50	7.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.47
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.03
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.60
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.56
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.11
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.61
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.24
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.74
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.77
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.65
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.27
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.24
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.17
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.15
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.87
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.37
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.64
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.55
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.11
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.85
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.86
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.75
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.65
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.59
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.55
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.45
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.94
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.94
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.62
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.34
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.88
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.44
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.30
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.22
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.08
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.86
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.88
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.00
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.99
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.10
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.79
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.61
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.33
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.19
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.17
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.91
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.50
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.30
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.85
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.26
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.00
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.51
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.36
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.94
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.45
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.72
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.21
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.46
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.21
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.12
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.73
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.60
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.59
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.49
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.46
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.13
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.82
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.96
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.87
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.46
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.16
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.15
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.09
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.62
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.59
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.45
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.89
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.62
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.22
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.96
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.74
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.73
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.69
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.35
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.35
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.07
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.68
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.58
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.21
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.95
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.28
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.64
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.61
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.38
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.20
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.04
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.04
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.52
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.83
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.50
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.73
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.57
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.26
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.09
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.91
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.72
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.81
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.53
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.36
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.