Gene detail

Detailed information of OS493_012762-T1 in Lophelia pertusa

Genomic Location: scaffold_33:2743248...2758299
NR annotation: KAJ7380000.1, Protein Smaug 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012762-T1

ATGAAACCAGCACATCACACGCTTTTTCGAGACCAAGTCAGCACATTGGTGGAGTGGTTTGCGAACTGGAATGAATGTGAACAGACCATCGCGTTGTATACACTGCTGAAACGCATCTCGACCATCCAGGCGAAGTTTCTCTCCTTGATTCTGGAGCACACATTTCGGGATGATTCGTTTGAAGTCCAAATGATGCAAAGACAAGCGAACGACAAAGAATTTTTAAGCAGTTTGATACACAAGAGTAAAGATGTTGCAGTTAAACAACTGCTGATGCATCTGCCTCTTCTGAATCCACGAAATGACGAGGCAAGATATGAATACCTTCATTTACTGCCCAAGATCCTTCATCACACCGTTGAACACTCTGTACATCAAGAAGAATGCCGTCAACTCTTATCGTTAGCTGTGGTGCATCCCGCCTTCCCGGCAGAGGAGCGGACTGCTCTTCACCGTTGGTTAAGCCAACTTGATAAGACCCTTGGTGTTCAAGAGAGGCTTCAAGCGACCAATTCGTTCATAACAGAAAATCCGGATGTGTTACCAAACACGGGCTGCGAGAACCTCGTCAGACAGAACTATATGCGAGGCCGGATGAATGGCTGGCGCAACCAGCAACTTGTTCACGTAGACTCTGGAATTGGCGGCTCATGCTCATTTGAATCGCCTCCAATGCAATCCCACCTTTCGATTTCGTCCTCTTTGAGGAAGAGTCGATCAAACTCTCTAACCCCTCCGCCGCCGATTGAAATCCAAGACTCCATTTTGGAGGATTTCTCTGAAAACAATGAGGTTGAAATTCGTCCGGGCAGGTCCCAGTCCTTTCCAGTGGATCCTCATAGATTAAATAATTCGCTTTCACCGCAGTCGTCGTTAGACAGTGAATATGATGAAAATGGCTGCAGACAGAGAGGAAGTAGTTTCAATGAAGATGCACGGCCAGGCATGAAAGATGTGGGGTCATGGTTAAAAAATCTAAGATTGCACAAGTATGGTAGTCTGTTTTCACAACTCTCTTACGAAGAGATGCTTGGCTTAGATGAGGACTACTTGGAAGACAAGGGTGTAACCAAAGGGGCCAGGAACAAGATCCTGCTAAGTATAAAAAAACTGTCGGAAAGATCAGAAACATTGGCTCGTCTGGAAAAGGAAGTGCTTCAGCCAGGCAAACTTCAAGGAGTTCTAAATGGACTAAAAGACATCATACATTCACCAATTAAACCATTTAACCCTCCTCCTTCTGAGGTCACGCACTGTGCTTCATACCCACCACCAATGACGACAGAACAACCACCGCCCAATTTACCGCCCCACCCAGACGACTTTGCTTCTAGAATTACAAGAGTTCTGGGTAAAGCCTGCACCCAGATTCTTGTGTCGAGGGCAGATGAGGAGCATTGCAACGCGTATCTTCACTGTTGGACAGAGTTCTTATGCTTGAGGGCTTTGCATGATAAATATACTGTAAAAAAGCTTGAGAAAGTACCGGCTACTGGTCATTCCTGTGAACTTGTAGAATACTTGGCATTTACGCAAACTCAAAAAGGAAGAATTCAGTCATGGAAGCAAGAATGCCAGAGACTTGTCAGACAAAGACGACCATCTCATGAGAACCGCGCAAGAGGATGGTACAACATGGGCCATAATTCAGGGGACTCCATAGGAGGGAGTATAGGGCCTCCTGCAGGTTCAGGGGTCATAAACAAGCGTCACAGGGGCTCACCTCGTAATCCTGCTAAGAATCCTGCTGGTCAGCTTCGAAGCAACAGTGCCGAGACACAAATGCACTCTAAACCAAGACTGGTGAGGTCCCATGCTATCGTGGGAAGAACAAAGTCGCTCCCTCTGAAACCAACACAGCAGACAAGTATCATTCTTCCGCAGCAGCTTTCAGCTGATCTCGAGAACATTGACGATGGTCTAGAGTCGCTTTGTCTAAGTGTTACAGAACATGCCCTTTCTGATTCTACGGACCATTCATTTGATTATAAATAA

Transcript

OS493_012762-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5FWP2	Protein Smaug homolog 1 OS=Xenopus laevis OX=8355 GN=samd4a PE=2 SV=1
Q8CBY1	Protein Smaug homolog 1 OS=Mus musculus OX=10090 GN=Samd4a PE=1 SV=2
Q0IHW3	Protein Smaug homolog 1 OS=Xenopus tropicalis OX=8364 GN=samd4a PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003202 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00536 all species →	SAM_1	SAM domain (Sterile alpha motif)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001660 all species →	Domain	Sterile alpha motif domain	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR037634 all species →	Domain	Protein Smaug, SAM domain	Interproscan
IPR037093 all species →	Homologous_superfamily	Smaug, PHAT domain superfamily	Interproscan
IPR050897 all species →	Family	SMAUG/VTS1 RNA-binding	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12515 all species →	STERILE ALPHA MOTIF DOMAIN CONTAINING PROTEIN 4-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0017148 all species →	Biological Process	negative regulation of translation	Interproscan
GO:0030371 all species →	Molecular Function	translation repressor activity	Interproscan
GO:0043488 all species →	Biological Process	regulation of mRNA stability	Interproscan
GO:0000289 all species →	Biological Process	nuclear-transcribed mRNA poly(A) tail shortening	Interproscan
GO:0000932 all species →	Cellular Component	P-body	Interproscan
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K27396	SMG; protein Smaug	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012762-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

265.5Max TPM

50.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	18.85	30.24
polyp at pH7 6	18	18	21.67	36.74
coral polyp · control treatment	16	16	48.52	115.50
coral polyp · oil and dispersant treatment	16	16	95.63	196.48
coral polyp · oil treatment	16	16	37.26	63.48
coral polyp · dispersant treatment	16	16	114.28	265.55
Polyp	10	10	9.50	20.32

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.24
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.35
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.25
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.91
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.29
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.46
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.67
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.57
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.98
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.27
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.78
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.92
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.22
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.81
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.47
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.95
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.45
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.64
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.74
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.15
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.82
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.28
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.48
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.17
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.68
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.54
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.44
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.00
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.01
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.71
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.28
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.12
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.30
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.95
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.91
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.43
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	115.50
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	71.06
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	69.91
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	63.26
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	60.81
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.84
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.95
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.78
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.33
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.97
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.78
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.44
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.87
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.86
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.40
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.56
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	196.48
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	177.36
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	143.64
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	130.40
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	108.07
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	94.42
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	92.40
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	82.02
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	81.14
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	79.81
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.32
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	72.32
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	72.28
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	57.09
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.68
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.65
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	63.48
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.40
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.77
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.79
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.67
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.24
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.59
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.23
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.73
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.73
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.51
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.56
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.80
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.42
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.88
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.35
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	265.55
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	184.00
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	152.80
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	136.72
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	135.80
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	135.36
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	130.91
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	129.68
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	120.68
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	108.53
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	105.23
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.43
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.05
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	64.27
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.81
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.70
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	20.32
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	13.31
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	9.49
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.53
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.38
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.10
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.64
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.63
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.62

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.