Gene detail

Detailed information of OS493_012949-T1 in Lophelia pertusa

Genomic Location: scaffold_34:1544466...1585640
NR annotation: KAJ7373357.1, hypothetical protein OS493_012949 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_012949-T1

ATGTCAACAACATCATGCAGCGACGAGTTTCATTTTGACCCAGAACAAGTGTTAGAATTTCTTGGCTTGTGTTTGAATAAGCAATGGAAAATTGCAAGAGCTGAATCATCCCCTGCTCTTCAAACATCTTCTATGTTGGACTGTTTGGCAATAATCCAAACAATAATTTCTTTTCTCCAGAAATCCAGTAGTGAACAAAATCTGTGCAACCTATTTGACCAACTGGCCTTGTGTCATATTCAAACACAAAATATTGATAATGGTTGTAGCCAGAGTCCTGCTCACAAGACTGTAAAACCCTGGAAAGATTTGGTGATCGACATGTTGGTTGATCTTTGTATCGTGCTGTTTGATGATCTGTTTTTCCCGGATTGTCGGAGCACAGCTGGGATGGCTATTCTGGTTGTCATCAAAGTGATGTGCCCAGTTGAATATGTTGTGTCAACAGTTGGAAAGTTGATATTCCCATCTTATATTCAATCTGGATACAGAGCTTTCTCTATCTTGAATGACCCAAAGATTGTTTCTATTTTTCAAGATTCTCAAGGGATTGCCAGTTTTTCCCATTTATGTCTTTGCCGTGGAGTCTTGGCTATGATTCCACTTCAGTTTTTAATTCAACCCTCTGAGATTATTTTAAACAACCAAGAAATGAGTGGAACCCTGATGTTTGATGTATTATTTCCAGACTTATGTTGTCTTTGTGATAGTTTAAAGGAATCCAGTAGATCCCTTCTAGCCTTCCGTACTCTGACCATGTGGGCAAATCAGGCCAGGCAAATAGCTATCAGTTATCACTCTGAGGTTTCATGGATAAAGGACAAATTGTATGGCACATCACCTATTCCAACCAAACTTCTGAATTATGTCTGGACCCACTGGGACCATCCAGTTGAGGGAGTACGATATCAAACCAGAATCATTTGTGAACATGTTGTAAAGATGCACTTCATTGCTGCACAGTCTGATTCCAATAAGGACACTTTTCTAAAAGACCTCACAGCATCTCTTCTTAAAGTAAGCTGGCATGTGAGGGGAAAATATGGCCCACTGTGCTGTATCACATCTGTTGTTGGAGCCACAAAGATGCTACTCTGGTTTCCAAAAATTCCTCATGATATGTTTCCTTTGATGAGAGATAGATGCCTTGCCCCTCATATAATGGAGTTTATAGAGAAAATGGCAAGTTCCCACAAACAAGAAATCGTAGTTGCTGGGGAAAACATTGAAGAATGGATGAAGATTTGGATTGTTCCATTGCTCCATTATCTCCATCATGGGTGCAGACTAATGAGAGAACACTTGGCACAGCATTGTCTCCCAAAGTTATTGAAGTGCTGCCCTGAAAGTCTGCAGTTTCTTGTTGAGTATCTTCAAGACAGCAATGGTCCAAAACTAAGTGACCTTGGGACCCTGATTACCTGTTTAAAGATAGCCCGCTCCTCAGGATTAATGGACATCTATAAAAAAAGTCATGAAAAGCTTGCCCTAAAAACCATGTCACTTTGGTGTGGGGTTGTACCAGTGGAGCTTATGAAGAAAGCTTTGTGTCATTTGGATGATCAGATTCGTCTTGATGCCCTTGGACTACTTTGTGATTCTCCTCGAACAACTGAGTCAGTAACAGAGGTTGACTTGCAGCTTCTGCAGTTGTTTATACCTCCAAATATGAACAACCAGGCTCCTTCCTTTAGGCAGCAAGCTGGAGCACATTTCAAAAAGTTCTTAATGAGAGTGAAGGAGGGCATCAGGATATCTAGTAAAGCTATCAAACAGAGAAGAAACATCACTGAGAAGCAGTTTCATCAAGACCAACTTGCTTTATACAGGGAATTTCTGCTATGGTTTTGTGCATGTCAGTTTGATTCCTTGTTTCCTGGTGCATCATTTACCCGTCGCACCACAGCTTTGAGTAGTCTGACGCTGATCAAGCAAATTTTTAGCTTTGAGCAAAGTGATGATTCTGCTACCAAGAGTGATAGTTTTAATATCAATGATGTCATGACCCAGGATAATATTTACATTCTTCTGGATTGTTTGAGTGATTCATATGAAACCAACAAGATGATGGCTTATGACATCCTTTTGGCAACACCTTCTGAGAAGCTTCCATTTCAGGAAGAGAAATCTTTGCTTGGATGGCTAAACATGATTGACAGATTGGTTTCCAGTCCTCGAGCAATAGATGCCTCTAGTGCAGCCACGTTACTAAGGTTACTTGTGGAGAAGTGCAGCTCTCCACTGACATTTAAAAAGCACAAGAGTGAAGAAGACAATGAACCCCTATCCATTGCCTTGAAATCAGAATGTGTACCATGTATGCAGGCCTTCAGAGTATTGAACTATTTAATTGGTTTGTTGAAGTCACACTGCTTAGCTGCCTCAAAGAATTTGTATCTAACTGGTGTCCAAGCCCCTATGCATGGTGTCCTCTATTGCCTAAGAGCAATCCTTGGTTCAATGTCATTCAGCTCCGTTGCAGGTAATGAACAATGGCAGAATCTTATCTCGCATCTCCTAAATGAATGTTTTTGTACAGCAGACATTGTTGCTCCTGTAGTGACCAGTTCCTCACCTGAAGGATTTATGGTGGATGATAATGAAGACCCAGATGAAGACTTAAGTCAGGTTCCTCAATATTCAGTTTTAGAAGAAAGTCATATAAAGGCCCCTGCTGCTCAGATCCTTTTAGTGTGTTGCTGGAGGACTATGAAAGAAGTAGCTTTGTTGTTAGGAGAGCTTGCTGACAATGCTCCATTGCAAGTTGCCAATAACAGAAATGGTTTGTTTACTGCTCAACAGTTGTGCAACATTGGTGGATTCTTTACCAAAGTACTGTTGACTTCAAAACACAGAGGTGCTTTTGAACTAGCATACACTGGCTTTGCTAAACTGTGTGCAGTTTTGTGGAGAAGTACAGATACAGATCTTCGCCAGCTACCAGAGCAATGGCTGCAGACATTATTAGATGACCTTACAAGTGATATTCCATCAGAGGCTTTGTGTGGCACAAGAAGGAGTGCTGGTGTACCATTTTTTATTCAGGCTATTGTGACAACTGAACCATCAGCAGCTGCAAGAGCATGCTTCAAACGAGTCATGATTGAGTTGTTGCGAATAGCATCTAAACCAACTGGGGATTTTAAGATCTGTGATTCAACTCTCCCACAGGTTCATGCTTGCAACATCCTTCGTGCCTTGTACCGTGAAACTAAACTTGGTGAGGGTGTGTTTCCTTTTGTATCTGATGGAGTAGTTGTGGCTATCAATGGATTCCACTCTGACAGCTGGGCAGTACGCAACTCATCCACATTACTGTTCAGTGCACTGGTGACCAGGATATTTGGAGTAAAGAGAGGCAGGGATGAGCATTCTAGAAAGAACTGTATGACAGGGAGAGAATTCTTCTCCAGGTTTCCAGAGCTTCATTCATTCTTCCAAAGTCATTTACAAGTTGCGTGTCAAGGAATTGACAGGGACAATACCATCCACCCCAGCCTTTATCCTGTCCTGGTAATATTGTCTCGTCTGTATCCATCAACTATGGACGGTGTTGACACAGTACTCAGCATGGCAGTGTTTGTACCTTATGTTATCAGCTGCAGAAAAAGTATGGTTATCAAGACTCGACTTATGTCTTCCCGAGCTATTGTTCCTCTAGTATCTGGTGATTTATTAGTTCAAACTCTTCAGAAGCTTCTTCTTTCCCTCCCATTGAGAAATGCATCACTACACAGATTGAAACTACCCAACAACAACCAGATCCTAAACACTACACAGATTGAAACTACCCAACAACAACCAGATCCTAAGAACAACAAATGA

Transcript

OS493_012949-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A8C750	tRNA (32-2'-O)-methyltransferase regulator THADA OS=Canis lupus familiaris OX=9615 GN=THADA PE=2 SV=1
Q6YHU6	tRNA (32-2'-O)-methyltransferase regulator THADA OS=Homo sapiens OX=9606 GN=THADA PE=1 SV=1
A8C752	tRNA (32-2'-O)-methyltransferase regulator THADA OS=Chlorocebus aethiops OX=9534 GN=THADA PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001294 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10350 all species →	DUF2428	THADA/TRM732, DUF2428	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019442 all species →	Domain	THADA/TRM732, DUF2428	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR051954 all species →	Family	tRNA (32-2'-O)-methyltransferase regulator THADA	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14387 all species →	THADA/DEATH RECEPTOR INTERACTING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0030488 all species →	Biological Process	tRNA methylation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11492	NCAPG2, LUZP5; condensin-2 complex subunit G2	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_012949-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

19.0Max TPM

6.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.08	15.68
polyp at pH7 6	18	18	6.48	16.87
coral polyp · control treatment	16	16	7.75	15.63
coral polyp · oil and dispersant treatment	16	16	7.49	16.99
coral polyp · oil treatment	16	16	7.35	16.08
coral polyp · dispersant treatment	16	16	7.87	19.03
Polyp	10	10	2.45	6.83

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.68
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.41
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.97
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.68
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.19
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.20
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.41
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.46
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.31
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.23
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.06
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.96
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.34
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.21
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.03
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.76
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.41
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.10
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.87
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.59
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.12
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.44
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.90
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.79
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.70
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.50
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.66
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.18
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.14
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.99
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.97
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.95
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.41
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.20
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.66
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.59
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.63
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.77
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.06
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.32
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.91
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.51
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.56
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.52
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.25
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.46
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.32
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.44
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.30
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.68
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.67
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.59
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.99
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.22
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.75
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.74
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.53
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.24
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.30
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.17
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.55
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.13
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.03
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.92
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.81
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.69
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.78
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.02
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.08
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.52
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.50
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.47
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.92
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.85
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.13
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.37
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.42
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.14
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.76
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.25
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.11
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.07
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.73
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.22
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.03
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.53
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.11
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.57
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.53
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.24
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.77
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.25
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.92
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.82
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.13
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.74
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.61
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.76
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.50
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.41
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.83
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.18
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.71
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.79
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.02
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.86
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.32
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.28
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.31
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.21

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.