Gene detail

Detailed information of OS493_013006-T1 in Lophelia pertusa

Genomic Location: scaffold_34:2179199...2210197
NR annotation: KAJ7373413.1, hypothetical protein OS493_013006 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013006-T1

ATGGCGGCTGATGATCAGGAATATTATGGCTACTACTACGACACCGAGGAAGATAGAGGGTTGCTTGATCCATCATGGGAAAGACAACAACGCAAGACGTTCACAGCATGGTGTAATTCTCATTTAAGAAAATTAAATAAGCAGATTGACAACATCGAAGAAGACTTATGCGACGGCTTGTGGCTTTTGGATTTGTTGGAAGTAATATCGGGAGATAAACTTCCCAAACCTGAGAGAGGACGAATGCGGTTTCATAAGATTGCCAACGTTAATAAAGCTTTAGACTTTGTGGCTGGCAAAGGAGTGAAACTTGTTTCGGTTGGAGCTGAAGAAATCGTGGATGGCAACCTTAAAATGACTCTTGGTATGATATGGACAATAATTCTGCGGTTTGCGATCCAAGATATAGCTGTAGAAGAATCGTTTGCAAAGGACGGCCTGCTGCTTTGGTGTCAGCGCAAAACAGCCCCATACAAAAATGTCAACGTGCACAACTTTCACACAAGTTTTAAAGATGGGTTGGCATTTTGTGCTCTTATTCATCGACATAGGCCGGATCTTATCGATTATAACTCGCTGAGCAAGGAGACTCCCTTGGAAAACTTGAATTATGCATTTGATGTTGCCGAGAAACATTTAGACATTCCAAGGATGCTTGATGCAGAAGACATGGTGAACACTGCCAAGCCTGATGAACGAGCTGTCATGACTTATGTCTCTTCCTACTATCATGCATTTACAAGCTCACAAAAGGCTGACACAGCAGCCAAGCGTATTGGCAAGGTACTCACCATCAATAGAGACAACGAGAAGATGATGGAAGACTACGAAAACATGGCCAGTGATCTTCTTGATTGGATCAACAAAACATTACCCGGGCTACAGGACAGAACAAGTGATGGGACATTGGATGATATGCAGAAAAAGCTTGATGCTCTTCGAGTCTACCGAAGAAGTGAAAAGCCTCCCAGAGTAGAAGAGAAAGGCATGCTGGAGACAAATTTTAACACCTTGCAGACCAAACTTCGACTTGGAAATCGACCTGCATACCTCCCAACAGAGGGAAAAATGATCAGTGACATCAACCGGGCCTGGGGAAACTTAGAAGGTTCAGAAAAAGATTTTGAAGATTGGTTGTTGACGGAAATGAGAAGAATGGAACGACTTGATCACTTGGCAGAAAAATTCAGACACAAATGCAATATTCATGAAGCTTGGACCTCCGGCAAAACTGACATGTTGACCAAAGATGATCATGAAAAAGCTACATTGGCTGATGTTCTGGCCTTGAAGAAGAAGCATGAGGCATTTGAAAGTGATTTAGCAGCTCATCAAGACAGAGTGGAGCAAATTGTGGCAATTGCCCAGGAGCTGAATCAACTGGGTTACAGTGATGTTGCTTCTGTCAATACAAGATGCCAGCAAATCTGTGATGAATGGACAGAACTTGGGCAGCTATCAAGAGATCGAGTGCTTAAACTTGAGGAACGTGAGGAGATATTACAGAAACTGGACTCCTTGTTGTTAGAGTTTGCCAAAAGAGCAGCGCTATTCAACAACTGGCTGGAGAGTGCAAGGGAAGATTTAATGGACATGTTCAGTGTGCATACTGTAGAAGAGATTGTGGAACTGCAAGATGCTCACCAGGTGTTCAAGGCAAACATGTCAGCTGCACAGGAGGAGTTTGAGAATATTATGGCTATAAGTCAAAAAATTGAGAGTCTGAGTGACCAGGAAAACCCTTACACTAGTCTTTCTAAAGAGGAAATTACTCTAACATGGAGTGAAGTCAAAGACCTGGTTCCTAAAAGAGACAAACTTCTTGAAAATGAAAAAGGCAGACAGGAACGGAATGAGAAACTTCGTTTGGAGTTTGCCCAGAAGGCTAATTTAGTTGGACCGTGGATCAAGGAAAATGAAGAAAAGCTACGATCCATTGCTTTGAAAATGCAAGGACCCCTGGAGGAACAACTGAAAGCTGTACAAGCACTTGAACGAGAGGTTGCTAGCTACAAACCACAAATGGATGAATTGGAATTAGTCCACCAGGATGTCCAAGAAGCATTAATCTTCGAAAACCCTCACACAGAATACACAATGGAAGCTCTTCGAGTGAATTGGGAGCAACTGCTGACTGCCATTGCTAGAAACATGAATGAAGTTGAAAATCAGATTCTTACAAGGGATTCCAAAGGTATCTCAGAGGAGCAGATGAAGGAATTCCGTACCTCATTTAACTTCTTTGATAAGGATGAAAATATGCGACTTGAACCTATCGAATTTAAACAGTGCTTGGTCAGTTTAGGATACAACCTGAAAGAAGGAGAAAAGGGAGACCAAGAATTTGAAAGGCTCATGACAATTGTCGATCCAAACAACACAGGACATGTAACTTTTCAAGCATTCCTTGATTTTATGACCCGAGAAACCGCTGACACAGATACTGCTGACCAGGTCATGGAGTCCTTCAGGATCCTTGCTGGGGACAAGCCGTACATCACTACAGATGAATTGAGGCGTGAGCTTCCACCAGATCAAGCTGAGTACTGCATTGCTCGCATGGCTCCTTATGAAGGTGCTGACGGAGTACCTGGCTCTCTGGATTACATGTCCTTCTCCACTGCACTATATGGCGAAAGTGATTTGTAA

Transcript

OS493_013006-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
L7UZ85	Alpha-actinin OS=Dermatophagoides farinae OX=6954 PE=1 SV=1
P05094	Alpha-actinin-1 OS=Gallus gallus OX=9031 GN=ACTN1 PE=1 SV=3
P18091	Alpha-actinin, sarcomeric OS=Drosophila melanogaster OX=7227 GN=Actn PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002750 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00435 all species →	Spectrin	Spectrin repeat	Domain	Interproscan
PF00307 all species →	CH	Calponin homology (CH) domain	Domain	Interproscan
PF08726 all species →	EFhand_Ca_insen	Ca2+ insensitive EF hand	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001715 all species →	Domain	Calponin homology domain	Interproscan
IPR002017 all species →	Repeat	Spectrin repeat	Interproscan
IPR036872 all species →	Homologous_superfamily	CH domain superfamily	Interproscan
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR018159 all species →	Repeat	Spectrin/alpha-actinin	Interproscan
IPR001589 all species →	Conserved_site	Actinin-type actin-binding domain, conserved site	Interproscan
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan
IPR014837 all species →	Domain	EF-hand, Ca insensitive	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11915 all species →	SPECTRIN/FILAMIN RELATED CYTOSKELETAL PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0030018 all species →	Cellular Component	Z disc	Interproscan
GO:0030036 all species →	Biological Process	actin cytoskeleton organization	Interproscan
GO:0030054 all species →	Cellular Component	cell junction	Interproscan
GO:0030864 all species →	Cellular Component	cortical actin cytoskeleton	Interproscan
GO:0042995 all species →	Cellular Component	cell projection	Interproscan
GO:0051015 all species →	Molecular Function	actin filament binding	Interproscan
GO:0055001 all species →	Biological Process	muscle cell development	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05699	ACTN1_4; actinin alpha 1/4	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013006-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

192.8Max TPM

108.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	117.98	169.71
polyp at pH7 6	18	18	118.98	173.35
coral polyp · control treatment	16	16	120.31	190.43
coral polyp · oil and dispersant treatment	16	16	102.77	188.19
coral polyp · oil treatment	16	16	107.84	192.83
coral polyp · dispersant treatment	16	16	104.52	151.24
Polyp	10	10	71.73	111.55

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	169.71
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	168.63
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	142.41
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	138.67
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	127.58
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	125.07
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	124.54
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	124.51
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	107.96
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	103.81
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	103.60
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	103.56
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	103.13
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	102.99
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	95.11
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	95.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	94.11
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	93.18
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	173.35
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	172.99
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	152.18
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	151.23
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	131.81
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	130.61
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	125.87
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	125.83
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	125.28
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	124.97
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	97.51
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	96.29
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	91.92
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	91.29
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	90.56
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	87.60
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	87.02
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	85.31
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	190.43
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	178.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	168.37
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	164.77
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	150.02
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	133.92
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	132.91
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	118.20
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	112.06
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	110.38
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	99.59
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	92.51
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	88.32
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.39
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	72.34
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.71
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	188.19
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	140.19
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	139.48
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	135.32
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	128.87
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	123.33
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	119.59
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	104.60
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	100.98
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.27
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	76.69
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	73.38
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.05
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	64.62
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.67
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.02
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	192.83
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	173.71
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	154.58
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	147.83
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	138.00
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	135.02
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	129.50
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	108.58
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	88.87
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	87.66
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	78.39
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	75.38
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	73.30
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	62.99
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.94
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.83
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	151.24
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	149.45
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	140.87
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	138.70
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	136.95
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	132.66
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	131.92
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	123.74
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	110.17
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	105.74
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	85.27
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	84.92
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.19
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	69.50
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.74
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.19
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	111.55
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	109.15
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	100.78
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	95.91
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	80.34
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	63.31
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	47.62
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	47.10
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	34.38
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	27.15

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.