Gene detail

Detailed information of OS493_013108-T1 in Lophelia pertusa

Genomic Location: scaffold_35:411340...421897
NR annotation: KAJ7362020.1, hypothetical protein OS493_013108 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013108-T1

ATGGTGCAGGAATATCAGTCGCCCGTCAGGGTTTATAAATATCCTTTCGAAATTGTCATGGCGGCATACGAAAAGCGCTTCCCTACTTGTCATATGATTCCGGTGTTTCTTGGCAGTGAAATTTTGTCCGAGTACAAAAGCGAAGACGGTGCGGTACACAACGTCGAGAGAAAGTGTAAACTGGATGTCGATGCGCCGTATTTATTGAAGAAAATTATTGGCGTGGAATTTGTCTATTTCAATCAAACGAACTGCCTGGACAGACGAGAAAGGACATTGACAATCACTGCTTTCAACGAGAGCTTTTCATCCCGTGTTGGTGTCACGGAACACTGCTACTACTCGGTTCACCCTGACAATCCTGACTGGACTTGTTTTGAGCAGGATGCGACATTGGACATCAAGTCATTCTTTGGTTTTGAGGCAGCTGTAGAGAAGCTAGCAATTAAGTTATATCTTCAGAATATCAAGAAGGGTAAAGAAGTAATCCAATTCTACATTGATGAGTTAATAAGTGAAGGAGTAACGTATCTGGTTCCATTTGAGAATTCACATGGACGACCAAGAACAAAAAGTGTAGCTGAAGCAGTAAGCAGTGCAGACCAAGCTGAAGAGCAGGACGAGAATGCTCTTCCTATTGCTAGCTCAGCGATAGAAGCTGCCGATGTGCTACCTCTTGCCTCTAGACCAGATTACAAGCTTGATGATGACTATATCCAGAGATTTCTTGGCACACTGAGCCCCAAAGAGGAGAATCAACTTATCAAGCTGCGCAAGAAACTAAGTTCTACACACCAGGGAAAGATGCCAAATGATGCTCATCTTTTAAGATTTCTGCGAGCACGAGACTTTAATTTAGACAAGGTGTATGAAATGCTGTGCGAGTCCCTGGCATGGCGGCGACACCACAACATAGACAATATAAGAGAAATATGGCAGCCTCCTGACCCACTGTTGAACTACTACTGTGGCGGGTGGCATAACACAGATAAAGAGGGCAGACCATTGTACATACTCAGGCTTGGATCCATGGATGTCAAAGGGCTATTGAAGGCTGTGGGTGAAGATGGCTTTCTGAAGCATGTTGTCTCAATCAATGAAGAAGGACTTAAAATGACAGAGGAACTGACAAAACAGACAGGTCATCCAATCAGCTCATGGACTTGTGTTTGTGATCTGGAGGGCTTGAGCATGAGACATCTGTGGAGACCTGGCATCAAAGCCTTGTTAAGGGTGATAGAAGTTGTTGAATGTAACTACCCTGAGACAATGGGACGGCTGCTGATTGTGCGTGCGCCCAGGATATTTGGTGTTCTGTGGACACTGGTTAGTCCTTTCATTGACGAAAACACAAGGAACAAGTTTCTCATTTATGGTGGAAATGACTATCAGGATCCTGGTGGTCTCACTGATTACATTGCAGCAGAGTACATTCCAGACTTCCTGGGTGGACCCTATGAGTGTAAAATCAAGGATGGAGGACTTGTCCCCAAGTCTCTGTACAGATCACTGGAGTTTTGTGAAGGAGAGGAGTCCTGGAGCAGTGAAATCTACCAAACATCTCATGTCAGCAAAGGCTCTCCTCACGAGGTCCTGGTGACTATCAAGGAATCTCAGTCTGTCATCACGTGGGATTTTGATGTGATGAAAGGAGATGTACAGTTCACAGTGTTCCGACACAAGCGTCCCCGCGAGGCAGTCAGCAGCACTAGTTTGACAAGTTTTGGAAGTGACATGTCCCTTCACCAGTCTGGAGTTATAGCCGGTGTAGATGCTGTGGTGGTGGAAAAACCAAGGCACTGTTATGATGGGGAATCCATACAGGGAACACATGTTTGCTCCATTCCTGGGGTGTATGTGCTACAATGGAAGTACAAATCAGGAGCACCGACAGGCCAAGCTCATGGGCGGCACACCAGGGCCAAGGTCATGTATTATCATGAAGTACTTCCCTCTGGAGAGTTTAGAGGATCATTATCAAGTTTGGAGTCCTGCCATAGTGGCTTCTCCCAACTAAGTATATCGACTGCAGCAAGTCACTCTTCTGGTGCAAGCAGTGCCTCACGCCCATCCAGATAG

Transcript

OS493_013108-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q92503	SEC14-like protein 1 OS=Homo sapiens OX=9606 GN=SEC14L1 PE=1 SV=2
Q0V9N0	SEC14-like protein 5 OS=Xenopus tropicalis OX=8364 GN=sec14l1 PE=2 SV=1
A8Y5H7	SEC14-like protein 1 OS=Mus musculus OX=10090 GN=Sec14l1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002018 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04707 all species →	PRELI	PRELI-like family	Family	Interproscan
PF03765 all species →	CRAL_TRIO_N	CRAL/TRIO, N-terminal domain	Domain	Interproscan
PF00650 all species →	CRAL_TRIO	CRAL/TRIO domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001251 all species →	Domain	CRAL-TRIO lipid binding domain	Interproscan
IPR036865 all species →	Homologous_superfamily	CRAL-TRIO lipid binding domain superfamily	Interproscan
IPR006797 all species →	Domain	PRELI/MSF1 domain	Interproscan
IPR036273 all species →	Homologous_superfamily	CRAL/TRIO, N-terminal domain superfamily	Interproscan
IPR011074 all species →	Domain	CRAL/TRIO, N-terminal domain	Interproscan
IPR051064 all species →	Family	SEC14-like and CRAL-TRIO domain-containing protein	Interproscan
IPR036598 all species →	Homologous_superfamily	GOLD domain superfamily	Interproscan
IPR009038 all species →	Domain	GOLD domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23324 all species →	SEC14 RELATED PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K26544	SEC14, SEC14L; phosphatidylinositol/phosphatidylcholine transfer protein	-	Transporters	ko02000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013108-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

107.0Max TPM

25.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.06	20.67
polyp at pH7 6	18	18	13.55	23.31
coral polyp · control treatment	16	16	28.45	49.50
coral polyp · oil and dispersant treatment	16	16	38.00	62.67
coral polyp · oil treatment	16	16	22.26	32.49
coral polyp · dispersant treatment	16	16	51.37	107.03
Polyp	10	10	7.47	9.87

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.67
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.92
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.30
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.14
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.93
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.76
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.55
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.93
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.58
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.39
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.27
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.88
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.86
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.47
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.06
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.15
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.36
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.83
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.31
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.92
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.97
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.66
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.81
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.69
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.26
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.58
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.63
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.06
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.70
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.36
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.14
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.22
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.12
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.93
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.46
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.11
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.50
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.16
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.57
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.12
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.71
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.43
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.42
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.29
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.26
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.37
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.94
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.75
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.73
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.62
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.03
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.24
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.67
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.45
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.47
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.37
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.80
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.11
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.45
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.72
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.52
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.52
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.38
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.08
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.30
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.24
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.85
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.04
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.49
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.80
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.19
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.70
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.50
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.46
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.01
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.58
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.14
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.68
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.53
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.37
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.47
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.56
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.91
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.73
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	107.03
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	90.98
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	86.44
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	73.49
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	66.86
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.03
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.50
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.22
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.62
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.86
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.48
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.59
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.75
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.47
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.27
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.28
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	9.87
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.83
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.61
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	8.58
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.56
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.08
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.98
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.91
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.19
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.08

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.