Gene detail

Detailed information of OS493_013117-T1 in Lophelia pertusa

Genomic Location: scaffold_35:481029...492923
NR annotation: KAJ7362029.1, hypothetical protein OS493_013117 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013117-T1

ATGTCGTCTTCCGATCCTGTAATGACTTCTCCTAGTACCATCATTTCTGCCGAAAATAAATTAGCTGCCTTTTCTCAAACTCAGCCGGAGAAGCCTTTCCACTACACGTACCTGAAGGAGTTTCGGGTCGAGCAATGTCCACTATTTCTACAGCACAAGTGTACAGCTCACAGACCTTTCACCTGTTTCCACTGGCACTTCATGAATCAACGAAGGAGGAGACCGAAAAAGAAAAGGGATGGCACATTTAATTACAGTCCTGATGTTTACTGCACTCAGTACGATGAAACGTCAGGGATTTGCCCGTCCGGCGATGATTGTCCCTATTTACACCGTGTAGCTGGCGATGTGGAACGTCGCTACCATCTTCGTTACTACAAAACTGCAACCTGTGTTCACGAGACCGATACTCGAGGATATTGTGTAAAAAATGGCCCACACTGTGCGTTCGCTCATGGACCTCACGATCTGAGACAACCGGTGTATGATATACGAGAATTACAAGCCATAGAAAAGGAGGAAACTGAAGTAGGACAGGCAGGAATAGAAAATAACAAAGCAGTTATAGAAGATCCCCGCTGGCAAGATACCAACTATGTTTTATCGAGTTACAAGACTGAACCGTGCAAAAAGCCACCAAGACTTTGCAGACAAGGCTATGCCTGCCCACATTATCACAATACTAGGGATCGTCGTCGCAGCCCAAGAAAATTTAGATACAGATCAACTCCTTGCCCTCATGTTAAGCATGGTGATGAATGGGGAGAGCCAACAAATTGTGAGAGTGGAGATAATTGCCCATATTGCCACACAAGAACAGAGCAGCAGTTTCATCCTGAGATATACAAGTCAACAAAATGTAATGATATGCAACAGACTGGCTATTGTCCCAGGGGACCTTTCTGTGCTTTTGCTCATGTGGATCAAGACACAATTGCTGCCAGAGAAGCCAATGGCGAGCCAAGTTTTAGTCAGTTTTATTCAATGCCTTCATCACCTCTTAGTCCTGTTGATAATGGAGTTGGATTTGTAGCAAGTTTAGTGCAATCAATCAGCAAGCCCACACGATCCATGTCGACATCGTCAGGAGGGTCATACTCCAGTGAACCATCCACTCCTTGTAGTTTATATCCAAAAGCTCCTGGCTCCGAACGTTCTGAACGAAGTGGAAGTAGAGAGGATGAGCAGCAGGCTTACATAAGAAAACAGCTTTTGTCAATTGAAAATGATCCAACTTTAGATGACCTTGAGAAAGCCAGAAGAAAACAGAACATAGTTGGTACAAGACAAGCCTTTTCCATTCCCAGTTCCAATCTGTCGTCAGTGTCTGCCAATGCTCCACCATTCTACCCTGCAGCTGACACAGTAGAATCTGTAGTAGAGAGTGCACTGGACGACCTCAACCTAGATGACTTTGATGTCACTGAATTAGAGAAGGAGCTTAATAATGCCTCGCCAGTATCGTCAACACTAGGAGATTCCTTGTCAGCATTGAACATAACTCCAATGTGCTCAGCACCAGTTACAATTCCAGGGGCAGCTGAAGCAATCTCACCCCAACCATTCACACAGTCACCCACTTCACCATTAGGACAGTTTTCTTCTTCTTATAGCTCCATGTCTGGACAAAAGGGCTCCAATCCTTACCGTTCCAGCCCATTAGTAAGAGGAAGCAGCCTCCATTCTTCTGTATTGGATCCACTCACAGCCCAACTCCATTCACCCAAGTCATTAGGTTCTCCCCAGTTGTCCTCTCCCTTGGGGCTCAGCAACAGTTCCTGTGAAATTCAGCGACTCAGTGAAGATCTCATGGCTGCCAAGACCAAGCTGGCGTCGTGGGAAGAGTCATGGGCTCAAGCCAAGCAGGCTTGCGATGCTTGGAAAAAGGAAGCTGAAGAATCAGCTAAAAAGGCAAAGGAAGTCGAAAAGGATAAATTAGAAGTTATTATGAAAAAGGAAGAGGTGGAATCTCAAGTGGCAAGCTTAAAACAAGAAATTGAAGAAATTAAAGGTGGCCCTCACCTTCACACACTAAACACAGTGGAAGATATCAGGGATTTACCGCTCTTAAAAATGAAACAGATTCATCGACAGCTTAGTTCAGATTTAGAAAAAATTTAA

Transcript

OS493_013117-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8BL48	RING finger protein unkempt homolog OS=Mus musculus OX=10090 GN=Unk PE=1 SV=1
Q9C0B0	RING finger protein unkempt homolog OS=Homo sapiens OX=9606 GN=UNK PE=1 SV=2
Q6EE22	RING finger protein unkempt homolog OS=Canis lupus familiaris OX=9615 GN=UNK PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005340 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF18384 all species →	zf_CCCH_5	Unkempt Zinc finger domain 1 (Znf1)	Domain	Interproscan
PF00642 all species →	zf-CCCH	Zinc finger C-x8-C-x5-C-x3-H type (and similar)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000571 all species →	Domain	Zinc finger, CCCH-type	Interproscan
IPR036855 all species →	Homologous_superfamily	Zinc finger, CCCH-type superfamily	Interproscan
IPR040594 all species →	Domain	Unkempt, zinc finger domain 1	Interproscan
IPR045234 all species →	Family	RING finger protein Unkempt-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14493 all species →	UNKEMPT FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_013117-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013117-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

129.3Max TPM

17.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	16.89	22.37
polyp at pH7 6	18	18	16.30	22.87
coral polyp · control treatment	16	16	25.56	129.32
coral polyp · oil and dispersant treatment	16	16	20.75	115.24
coral polyp · oil treatment	16	16	18.19	24.88
coral polyp · dispersant treatment	16	16	11.82	22.14
Polyp	10	10	13.40	17.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.37
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.47
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.38
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.73
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.36
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.25
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.74
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.30
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.53
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.25
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.15
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.06
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.99
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.06
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.24
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.10
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.01
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.02
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.87
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.37
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.82
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.40
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.97
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.79
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.67
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.42
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.41
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.61
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.13
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.90
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.86
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.35
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.96
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.61
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.24
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	129.32
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.98
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.67
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.66
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.66
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.24
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.19
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.40
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.25
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.67
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.83
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.65
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.95
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.77
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.50
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.25
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	115.24
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.46
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.54
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.85
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.75
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.30
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.35
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.22
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.21
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.03
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.74
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.61
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.91
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.14
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.85
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.79
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.88
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.30
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.87
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.15
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.97
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.64
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.17
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.74
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.42
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.78
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.86
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.41
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.11
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.01
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.28
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.40
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.14
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.51
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.29
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.66
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.33
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.31
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.26
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.80
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.62
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.20
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.97
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.76
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.68
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.42
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.32
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.89
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	17.73
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	17.57
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	17.30
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	16.20
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	14.34
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.59
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.45
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	10.38
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	9.12
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.36

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.