Gene detail

Detailed information of OS493_013203-T1 in Lophelia pertusa

Genomic Location: scaffold_35:1147636...1162524
NR annotation: KAJ7362112.1, aconitate hydratase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013203-T1

ATGCAACGAGTATTTACCAGAAAGGCTATGTTTTCTGTCCGAGCGGCAGTCTATCATGGCAGACTCTTCACTACTTCATATGTGGCTGCTCAAAAGGTGGCATTGAGTAAATTTGAATCAGACCATTATCTGAACTATCAACACTTGGAAGACAATTTGAGAATAGTCCGTGATAAGCTTAACAGGCCATTGACTCTCTCTGAAAAAATTCTTTATTCTCATTTGGATGACCCAGCAAATCAGGATATACAAAGAGGTGAATCATACTTGAAGCTGAGACCTGATCGAGTTGCTATGCAAGATGCAACAGCTCAGATGGCTATGCTTCAGTTTATCTCCAGTGGACTTCCTAAGGTTGCTGTTCCAACAACTATCCACTGTGATCACTTGATAGAAGCTCAGGTGGGGGGCGTTCAGGACTTGGAGAAGGCCAAGAAAATCAACGAAGAAGTATACAATTTCTTATCCACAGCATCAGCAAAGTATGGTGTTGGCTTTTGGAAACCAGGCAGTGGAATTATACATCAAATAGTTCTGGAAAATTATGGTTTTCCTGGAGTGCTGTTGATTGGTACTGACAGTCACACGCCAAATGGAGGTGGTCTTGGTGGTCTGTGTATTGGTGTGGGCGGAGCAGATGCAGTCGATGTTATGGCAGATTTACCATGGGAACTCAAGTGCCCCAATGTAATAGGAGTGAAACTGACTGGAGAGCTTAAGGGTTGGACATCACCTAAAGATGTTATCCTGAAAGTGGCTGGAATTTTAACAGTAAAAGGAGGAACTGGTGCTATTGTAGAATATTTTGGACCTGGAGTAGATTCCATTTCCTGTACAGGAATGGGAACAATTTGTAACATGGGTGCTGAAATTGGTGCCACAACGTCAGTGTTTCCATATAACTACAGGATGGAAAAATACCTCAAGGCAACTGGCAGGACACAGATTGCTGACCTTGCCAACAAACATGCCGCTTTTCTTCAGTCTGACAGTGGAGCAGACTATGATCAAGTTGTTGAGATCAATCTCAGTGAGCTTGAACCACATGTGAATGGTCCGTTTACACCAGACCTGGCCCATCCTATCTCTAAATTGGGCTCAACAGCTAAAGAGAAAGGCTGGCCAATGGACATTAGAGTTGGTCTAATTGGAAGCTGCACAAATAGTAGTTATGAAGATATGACAAGAGCCTCAAGTATTGCAAACCAAGCTCTCAAACATGGACTTAAGTCCAGGTCATTATACACAGTTACTCCTGGATCTGAACAGATTCGTGCAACCATTGAAAGAGATGGAATTGCTGAGACGTTAAGAGAATTTGGAGGAATAGTGTTAGCAAATGCTTGTGGGCCTTGTATTGGACAGTGGAACAGACAAGATATCAAGAAAGGAGAAGCTAACACAATAGTGACATCATACAACCGAAATTTCACAGGACGTAATGATGCTAACCCCGCAACTCATGCTTTTGTCGCTTCACCTGAGATAGTGACAGCGCTGTCTATTGCTGGTGACCTCAGTTTTAACCCTGAAACAGACTCTTTAACTGGCACAAATGGTGAATCATTCAAACTTGAGAGTCCTTATGGTGATGAACTGCCCAACAAGGGTTTTGATCCTGGCGAGGACACATACCAGGCCCCACCAGTAGACAGTTCGTCTGTTTCAGTAGACATCGACCCTGAAAGTAACCGGCTTCAACTTCTCACTCCATTTGACAAGTGGGATGGCAAGGACCATGAGGACATGACAATTTTGATCAAGGTGAAAGGCAAGTGCACAACAGACCACATCAGCGCTGCAGGTCCATGGCTCAAGTACAGAGGCCACTTGGATAATATTTCCAACAACATGTTTATTGGAGCCATCAACAGTGAGAATGACAAAGTAAACCAGATCAAGAACCAGGTGACTGGAGAGTATGGAGCCGTGCCTGACACTGCACGAGACTACAAGGCAAAAGGAGTAAAATGGGTTGTTGTCGGAGATGAGAACTATGGTGAAGGAAGCAGTAGGGAACATGCAGCTCTTGAGCCGAGACATCTTGGAGGACGAGCAATCATTGTCAAGAGTTTTGCACGTATCCACGAAACCAATTTGAAGAAGCAGGGACTTTTGCCTTTGACGTTTGCTGATCCATCAGACTATGACAAGATTCAGCCTGAAGACAAGCTCTCTCTGCTGGGTCTTAACGACCTTGCGCCTGCAAAGCCCGTGAAGTCTGTGGTGAAGCACAAAGATGGCAGCCAAGACGAGATCCAACTGAATCATACCATGAACGAGCCACAGATTGAGTGGTTTAGAGCCGGCTCGGCACTCAATAGAATGGCCGAAGTGTCTGGAAAGTAG

Transcript

OS493_013203-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q99KI0	Aconitate hydratase, mitochondrial OS=Mus musculus OX=10090 GN=Aco2 PE=1 SV=1
P16276	Aconitate hydratase, mitochondrial OS=Sus scrofa OX=9823 GN=ACO2 PE=1 SV=1
P20004	Aconitate hydratase, mitochondrial OS=Bos taurus OX=9913 GN=ACO2 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004434 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00694 all species →	Aconitase_C	Aconitase C-terminal domain	Domain	Interproscan
PF00330 all species →	Aconitase	Aconitase family (aconitate hydratase)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015931 all species →	Homologous_superfamily	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3	Interproscan
IPR015932 all species →	Homologous_superfamily	Aconitase, domain 2	Interproscan
IPR000573 all species →	Domain	Aconitase A/isopropylmalate dehydratase small subunit, swivel domain	Interproscan
IPR018136 all species →	Binding_site	Aconitase family, 4Fe-4S cluster binding site	Interproscan
IPR001030 all species →	Domain	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha domain	Interproscan
IPR015928 all species →	Homologous_superfamily	Aconitase/3-isopropylmalate dehydratase, swivel	Interproscan
IPR036008 all species →	Homologous_superfamily	Aconitase, iron-sulfur domain	Interproscan
IPR006248 all species →	Family	Aconitase, mitochondrial-like	Interproscan
IPR050926 all species →	Family	Aconitase/IPM Isomerase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43160 all species →	ACONITATE HYDRATASE B	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003994 all species →	Molecular Function	aconitate hydratase activity	Interproscan
GO:0006099 all species →	Biological Process	tricarboxylic acid cycle	Interproscan
GO:0051539 all species →	Molecular Function	4 iron, 4 sulfur cluster binding	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01681	ACO, acnA; aconitate hydratase	EC:4.2.1.3	Carbon fixation pathways in prokaryotes	ko00720	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013203-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

465.1Max TPM

68.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	78.79	112.40
polyp at pH7 6	18	18	74.97	105.88
coral polyp · control treatment	16	16	86.96	465.14
coral polyp · oil and dispersant treatment	16	16	73.80	387.72
coral polyp · oil treatment	16	16	62.78	102.52
coral polyp · dispersant treatment	16	16	43.28	76.55
Polyp	10	10	48.36	74.59

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	112.40
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	111.11
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	110.49
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	106.91
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	91.27
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	90.18
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	82.82
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	80.05
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	76.22
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	75.17
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.77
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	65.38
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	61.98
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	60.20
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	58.00
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	57.81
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.06
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.37
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	105.88
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	104.21
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	89.53
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	88.50
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	86.50
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	83.45
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	82.33
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	77.04
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	75.54
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	73.88
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	69.40
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	65.22
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	64.57
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	63.41
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.57
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.98
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.93
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.57
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	465.14
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	73.47
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	70.82
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	67.34
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.51
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.74
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	64.66
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	64.56
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	64.14
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	63.96
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.25
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.96
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.57
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.99
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.15
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.06
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	387.72
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	77.04
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	73.12
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.31
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.09
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.54
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	55.20
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.62
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.68
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.23
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.31
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.58
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.55
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.41
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.74
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.72
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	102.52
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	78.54
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	72.41
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	69.55
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	69.39
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	69.07
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	62.43
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.84
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.62
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.73
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.02
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.52
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.11
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.93
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.68
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.06
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	76.55
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	60.94
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	57.67
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.24
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.09
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.38
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.21
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.99
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.23
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.16
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.32
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.22
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.15
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.72
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.81
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.74
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	74.59
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	70.54
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	55.42
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	52.65
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	50.34
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	41.40
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	39.43
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	36.45
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	33.92
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	28.90

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.