Gene detail

Detailed information of OS493_013271-T1 in Lophelia pertusa

Genomic Location: scaffold_35:2131673...2151229
NR annotation: KAJ7362177.1, Milk fat globule-EGF factor 8 protein [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013271-T1

ATGGAAAGACGTTTACACTCAATCCAATGCATCATTTTGAGTTTGGTGTTTTTGAAGTGTCTTGCTAGCGAAAAAGCTCAGAGGCCTAAATTAAAACTTCAACTCGTCGTAGATGACAGCAAGCCATTGTTTCAAGGAAACAAAACCACACTTCACGTCAATTTGACTCACGACAGCAGTTCATCGTCAGCCGCAACTCAAGTAACACTCCAAATACAAGCTTCTTTAAAAGCAGAGTTTGGCTCGGTTACTTTATCTCCAGAATCAGTGTATCCAGATGCGGAACAACAGAACGGCATCGAGGTCTACAGGCTTGAACTAAACGATGAATTATCAGGTCAAATGGATGTGTCTATTGACCCTCATGGACTCACCGAGCCTGGTCGCACACACATTGCCCATGTGATCGCTACATTGTCATACAGCGGCGATCAAGACGATTACACAGACCCAATCACCGGGAGAAAGCTAGAGAAAGTCATAGAGAATGCTTATACGTCTTTCTACTTCTACGTTTTAGATTCAGATTGTGTACAACCGCTGGGTATGAAGAGTGGGCGCATCAAGGAGGGTCAGCTATTTTCATCATCATTCTACAAAGAAACCCATCATTCACTTGGTCACAGTCCCCACCGAGCTCGGCTTGATGGGCCAGGGTACTGGTCACCAGTTAACGGAAATGCTTCTACTGATGGTGAGCAGTTTCTACAAATTGCTTTTGAGACACCTATTCAGCTGAAAATGGGAAAACCGAATTCTACTGAGCATGTCAAGACGTTTGATGCTTTTACGAGCATCGATGGAGAGGTGTGGAAGATGGAAAAACAAATACTTCCAAAGGTTGTTATCAATATAAATAATGGGGATACCGCGGTTCCAACTGCTTACCAGTCTCTTGCTGCGACGCGCTTTCTACGAATACAGCCGAGAACCTGGTACAAAGAAAGTGCTCTTCGGGTCGAGGTTTATGGGTGTATTCTTCCAGCAACGCCAACACAAGAAGACTTTCCTGCTCTCGGAGTTGAGAAGCAGTTAATTACTGACGCTCAGATGACAGCCTCTTCCGCTTCTGATCCAGTCACGACAAGCGCTTCCAGCGGCCGCTTAAACTCTAACAGTGCTTGGTGTTCGGCAACTTCCAACGAACAACCGCTTTTTCTTCAAATTGATATGAATGAAATACATGTCATTACAGCGATTTCTTCTCAGTCACGCAACACGAATGAAGACAGTTTTGAAAGCGTGGCAAGGTACAAGTTGGGTTATTCCGAGGATGGGTCTAGTTGGAGCATTTATCAACAGAATGGGGTCGACAAGGAGTTCCTTGGGAGCTTAGTTGAGGATATTATAACAAAGCATCACCTGGTTATTCCAGTGAAGGCGCGATACATTCAGTTTCAACCAATAGGAACGATCTCCTCTGTGTGCATGCGCGTTGAACTGTATGGGGAAAGGTCAACTGCAGAAAATACTGATAAGCCTCCAGTGTATCAACGAAGTATCCTTTTAGATGCTGACAATCGAATACTTTTCTTATGCAATAAAGATGTAACCAGCGGTAAATCCGTTTGCTACATAAGAAAATACGTAGACGATGAAAGTTGGATAGCCATGGACAGACGCATCGTCAGCATTCTTGGCTACGACAAAATACAGGACATGATTTATGGTGTGGCGAGAAACAGGAAATCCTACGTACGATGCGATATCACCAAATGTGTGTCCATTACGAAGGGGTCTTGGTTAATGATAAGAGATAAAAGTACCACAATCTTAGCCACGGAGATTGCCTTTGTCCCAGAGACGGCGTCAGCTGTTGGTGTACACCTTTACCGAGAACAAGAGAAGGCATGGAAATTGAAGGCCAAATGGCGAGCTAAGGATCTAAATAGGTGCTACAGTGGACCCTGTGAGAATGGTGGTTCTTGTGTTGGGAATAACAAAAACTACACTTGCACTTGTACAAAAGACTGGATAGGAAGAAGTTGCGAAACCGCTGTTGTTCCCCTTCGAGTTCAAGTTATCAATTTCAGCTGTAATGAAACCACGAACAAAGAACCAGGAACAATAAACAGTCCAAATTACCCTAAAAAGTACAACAACAGCGATCGTTGTTCTTGGCTTATCAATTCCTCGCACCGAGTTCGACTCGTGTTCAAGTCGTTCTCAACTGAACGAGGCTTCGATTCTCTGTTTGTCTACGATGGAAGTTCCGCGTCTTCTCCAAAGATTGGCAAATACCATGGACATCTGCAGGGTAAAGTCGTCGAAAGTTCGGGAAGGTCCTTATTTGTTAAGTTCAAATCTGACTCGAGCGTAAATAAACCTGGATTCTTAATACGTTTCGAAGCTGTATCCACGGCCCCATCAAACTCAACAAGCCCACCAAACCAGTAA

Transcript

OS493_013271-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P98070	Bone morphogenetic protein 1 OS=Xenopus laevis OX=8355 GN=bmp1 PE=1 SV=1
Q96PZ7	CUB and sushi domain-containing protein 1 OS=Homo sapiens OX=9606 GN=CSMD1 PE=1 SV=3
Q923L3	CUB and sushi domain-containing protein 1 OS=Mus musculus OX=10090 GN=Csmd1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0011776 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00754 all species →	F5_F8_type_C	F5/8 type C domain	Domain	Interproscan
PF00431 all species →	CUB	CUB domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR035914 all species →	Homologous_superfamily	Spermadhesin, CUB domain superfamily	Interproscan
IPR000421 all species →	Domain	Coagulation factor 5/8 C-terminal domain	Interproscan
IPR008979 all species →	Homologous_superfamily	Galactose-binding-like domain superfamily	Interproscan
IPR000742 all species →	Domain	EGF-like domain	Interproscan
IPR050633 all species →	Family	Neuropilin/Multicopper Oxidase/Coagulation Factor	Interproscan
IPR000859 all species →	Domain	CUB domain	Interproscan
IPR001881 all species →	Domain	EGF-like calcium-binding domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46806 all species →	F5/8 TYPE C DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007411 all species →	Biological Process	axon guidance	Interproscan
GO:0017154 all species →	Molecular Function	semaphorin receptor activity	Interproscan
GO:0030424 all species →	Cellular Component	axon	Interproscan
GO:0038023 all species →	Molecular Function	signaling receptor activity	Interproscan
GO:0098978 all species →	Cellular Component	glutamatergic synapse	Interproscan
GO:0099055 all species →	Cellular Component	obsolete integral component of postsynaptic membrane	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_013271-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013271-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

87TPM > 0

7Conditions

1.6Max TPM

0.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	14	0.44	1.04
polyp at pH7 6	18	8	0.16	0.73
coral polyp · control treatment	16	16	0.54	1.64
coral polyp · oil and dispersant treatment	16	12	0.28	1.28
coral polyp · oil treatment	16	15	0.35	0.82
coral polyp · dispersant treatment	16	14	0.21	0.66
Polyp	10	8	0.45	1.03

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.04
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.00
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.95
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.81
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.54
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.54
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.49
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.49
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.42
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.42
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.36
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.36
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.26
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.17
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.73
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.54
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.53
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.33
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.23
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.21
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.20
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.17
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.64
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.31
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.89
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.86
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.76
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.61
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.58
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.35
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.32
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.30
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.28
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.27
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.19
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.17
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.12
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.05
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.28
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.77
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.49
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.37
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.31
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.27
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.24
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.23
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.19
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.13
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.11
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.04
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.82
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.66
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.53
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.47
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.46
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.40
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.38
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.38
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.37
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.34
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.20
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.18
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.16
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.15
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.07
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.66
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.42
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.34
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.28
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.25
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.23
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.21
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.20
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.18
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.15
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.12
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.09
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.08
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.07
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.03
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.94
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.64
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.53
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.44
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.37
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.31
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.22
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.