Gene detail

Detailed information of OS493_013412-T1 in Lophelia pertusa

Genomic Location: scaffold_36:2000202...2009759
NR annotation: KAJ7336037.1, hypothetical protein OS493_013412 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013412-T1

ATGGCAACGACGATTTTCAAACTTCTGCTCTTAGCTTTTATCGGTCGAGAATATGTCTATGGCTCACTTCGATCGATCGGGCTGGGACAGAGATACCCAAACGCCGATGAGATCGATACATGTGGAAATATCAGGGACGTTATCAGAAGAAATTCAGCTCGCTACAGAAAGATCCTTGTGAGAAATACGAACTCCGAAATAGCGTTTGCCAATGACGATTGCCGACGAATGAGTGCAAGAGCAAAGAGCAAGCTTGATGTGTTGGGCTCTAGAGTTAGACAACAATGGAGTAACATAAAATTGAAGGTGACGCTCGCTTGGACAGATCAAATCATGCCACAAGCACCAATTTCACTTCATTATGAAGGACGCGCTCTTCGTCTCCAGACCTCTGATGGCGACAGACAAAAGCTCTCTACTTTAGCAGGCCTGGCTGTAGAGGCAGGATTTGACTGGGTTCACTATGCAACCAGTTCATATATCCATGCGAGCGTCATTCGAGATGTTTGCCAGACATCAGTTGATTTAGCATTTATCCTGGACAGTTCAGGCAGTGTTGGAAGCTACAATTTTAAGAAAGTAAAGATTTTTGTCAAGAACATTGTGGACTTCTTTAACATTGGTTCATCCGGGACACACGTGGCTGTTGTGACGTATTCCACATATACGAAGCTGGAGTTTAATTTGAAAGCGTATTACACCAAGACATCGATTAAGAATGCAGTGGGAAATATCAAGTACCGAGCGGGGTGGACTTACACCGCTGACGCATTGGATTTTGTGCGCACGAACATTTTCACCACATCACAAGGCATGCGTCCGGATCAAGGGATTCCTAAGGTGACCGTGTTGCTCACTGACGGTTACTCAAATGGTCGCGGTGTATCCGGTCCCGCCAAACAACTCCGTAAGTTAGGCGTGAACATCTTCTCCATTGGTGTGGGACATTACGTCAACCCAGCAGAGCTGAATGACATAGCCTCTGATCCTGATAGCACGCACGTGTTCCGAATGAACAGTTTTAACGACTTGAATGGATGGGTGGACAAACTCAGTGCTGTGTCGTGCGATGAGGGTGCTTCCATCTCCTCCTGCGATGACACAATCACCACTGTGGAGAGTGACACGTTTAAATATTTCAGGACTCAGTTTAGTACCGTGGCGAATAACAGAATATCAGTGGAAGTGAGAGACATTGAAGGAATCTCGCATCTCTATGCATCGCTAACTAGCACCAACCCAGGCCCCATGGATCCTGCCTCGGCCAAGAATGAAAGCAATATCTCTCCTCGGGCCATTTCTCTTTCGCTGTCGGCAGCAAACACGATTGTGTATGTAGCTGTTCAAGGTCAAGAACAAAGCAATAAATTCAAGCTATCCATGTGGGATGCTCTCTTTTCTCAAGACACGTACGTGACCAGTGTCAAGGAAGAACAGTCTGCACCTGTCACGGTGCTAGATAAAACACTCACGCCGTACAATTACAAGCTCAAGTACAGCATTGTTGAGGGGGACGATGACAACTGCTTCAAAATCAACAAAGACACAGGAGTTATCACAACAACAAAGAAGTTAGACCGCGAGGCACGTGCATCATATCGCCTGACTGTTCTCGGTCAGAACGCTCAAAACAGTTGTCACAAAGGTCGCGCTGTTGTTCTAGTTGATGTAGAGGACATTAATGACAATTCACCCGTCTTCGGACAATCTTCGTATTCTGCAACTCTACCGGAAGGAAAGCCCGCCAATACGTTTGTTGCCATGGTTACTGCCACTGATAAAGATACTGGAACGAACGCGCAACTGTCTTACAACATTACGTCAGGAAATGAAGATAACAAATTCTCGATTGACAACAACGGCGAAGTCAGAACCACTAAGGTGTTAAACTATGAAGACATAAGTAACAGCTATAGTCTGAAGATTACCGTTAAAGATGGCGCACAACCCAGTTTGAGCGACACTGCAACACTTACAGTTATTGTACAAGACGTCAACGAACCTCCGTACTTTGTAAATAACTGTGCACATAATAACACTTGTAAATTCTCGGTGAAGGAAAATAACAACCGTAACGCCCGCCTGGGTATGATACAAGCCAGAGATCCCGACACGAGCTGCAACACTTTAACTTACAAAATCACCACACAACAGTCACAGAATAATCAAATTTTCGCCATTAGCAACAGCGGGCAAATAACAGTGCTTTCAAAACTGGATCGTGAGTTCAAGTCTCATTACACGGCGGTGGTCACTGCGCAAGACTGTGGCTCGCCTTCTTAA

Transcript

OS493_013412-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P32018	Collagen alpha-1(XIV) chain OS=Gallus gallus OX=9031 GN=COL14A1 PE=1 SV=2
Q05707	Collagen alpha-1(XIV) chain OS=Homo sapiens OX=9606 GN=COL14A1 PE=1 SV=3
Q80X19	Collagen alpha-1(XIV) chain OS=Mus musculus OX=10090 GN=Col14a1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000235 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00092 all species →	VWA	von Willebrand factor type A domain	Domain	Interproscan
PF01085 all species →	HH_signal	Hedgehog amino-terminal signalling domain	Domain	Interproscan
PF00028 all species →	Cadherin	Cadherin domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002126 all species →	Domain	Cadherin-like	Interproscan
IPR002035 all species →	Domain	von Willebrand factor, type A	Interproscan
IPR015919 all species →	Homologous_superfamily	Cadherin-like superfamily	Interproscan
IPR001657 all species →	Family	Hedgehog protein	Interproscan
IPR009045 all species →	Homologous_superfamily	Hedgehog signalling/DD-peptidase zinc-binding domain superfamily	Interproscan
IPR000320 all species →	Domain	Hedgehog, N-terminal signalling domain	Interproscan
IPR036465 all species →	Homologous_superfamily	von Willebrand factor A-like domain superfamily	Interproscan
IPR050971 all species →	Family	Cadherin domain-containing protein	Interproscan
IPR020894 all species →	Conserved_site	Cadherin conserved site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24025 all species →	DESMOGLEIN FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0007156 all species →	Biological Process	homophilic cell adhesion via plasma membrane adhesion molecules	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0007267 all species →	Biological Process	cell-cell signaling	Interproscan
GO:0007275 all species →	Biological Process	multicellular organism development	Interproscan
GO:0005911 all species →	Cellular Component	cell-cell junction	Interproscan
GO:0098609 all species →	Biological Process	cell-cell adhesion	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007155 all species →	Biological Process	cell adhesion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_013412-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013412-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

100TPM > 0

7Conditions

14.9Max TPM

3.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	16	2.01	4.83
polyp at pH7 6	18	16	3.15	9.91
coral polyp · control treatment	16	16	4.64	12.27
coral polyp · oil and dispersant treatment	16	15	4.26	11.36
coral polyp · oil treatment	16	16	2.51	7.62
coral polyp · dispersant treatment	16	15	5.62	14.93
Polyp	10	6	0.21	1.02

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.83
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.45
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.72
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.91
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.84
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.73
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.57
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.20
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.03
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.77
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.64
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.62
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.02
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.82
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.55
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.55
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.91
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.17
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.25
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.88
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.17
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.88
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.69
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.50
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.44
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.21
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.75
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.26
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.12
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.96
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.78
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.68
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.27
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.24
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.15
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.59
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.43
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.27
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.48
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.39
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.17
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.02
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.71
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.20
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.01
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.49
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.64
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.18
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.36
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.15
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.63
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.37
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.76
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.38
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.20
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.64
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.59
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.48
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.38
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.18
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.79
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.43
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.86
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.62
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.67
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.57
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.14
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.83
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.68
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.28
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.17
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.61
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.36
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.28
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.99
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.80
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.80
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.22
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.21
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.93
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.32
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.33
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.12
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.67
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.40
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.27
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.79
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.35
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.17
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.82
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.03
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.96
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.70
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.13
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.02
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.43
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.30
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.15
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.13
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.10
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.