Gene detail

Detailed information of OS493_013517-T1 in Lophelia pertusa

Genomic Location: scaffold_37:591270...603522
NR annotation: KAJ7392145.1, calcium ion-regulated exocytosis of neurotransmitter [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013517-T1

ATGGTGAGGAGATTCGAAGGGGGTCAAAATCAATTTGCCGATAATTCAACCCTCTACGATACGGCTTCGGAAAACAATGCTTCGACTGGGACAAAATTTCCAGTCCTACCCGTGGTGTTAACAGTTGCTCTTGGTTCGCTAACTGTTATTCTCGTGGTCACGTTGTTTCTCATTAGAAGACAGCGTCAACAGGCACAAAAATACAAACAGTACTCTCAGATAGCGAAAACCGCTGTTCAGCCACCGGAATTCACCGTAAAAACGGCTCAACAGACTCTCGCGCCAAAGAAAAAGCTACGTCGCCTGCCAGAGAAAATCCTGTCCTCAGAAGAATCACTTTCACCGATGTCCAGCGAAGAGATGTTCTTCGACGCGCAAGAGAAACTTGAAGGGAAAACATCGAGATCGGTTTCCAGTCGTGAGCCGAGCCCGGCGCTCGAAGATGCTGACGTTGAAGAGGAAGATGAAATGTACCCTATAGGCCATCTCGGGCGAATTTGGTTCAATTTAGGATACGATAGATCAGCTGAAAGTTTAGTGGTCACTTTGGTAAAAGCGCGAAATCTTTCGCCTCGCAGTAAAGCTGTGAAAACGTGCGATCCCTTTGTGAAACTGCACATTTTGTGTCCGGAAGAGAAAAACGTCTCGCAGAGTAAGTGTAAACGGAAAACACGCCGGCCAAACTTCGACGAAATGTTTTATTTCAATCTGCCTGTTGCGGAGCTCGTGAGGTGTACACTTCATTTGTCTGTATATGACGGGTATAGAGCGAGCCAGCAAAGTGTGATTGGGGAAGTCCTGTTTCCTTTGAACGAGTTGGACACAGAACAGAATGTTGAATTGTGGAGAGATCTCGTGGCTATTGAAGAGAGCCCATCTGAACTCGGCGAAATCCATATCACTATGTCTTACTACCCTACCCTGGACAGGCTTACAATTATTGTTCTTAGAGCAGCCAATCTTAAGAAAATGGAGCCCCACGGGACAGATTCATACGCCAAAGTGACGTTTTCAATTGGAAATAAAATAATCAAGACGAAGAAAAGTACTGTCCATCATTCAACACGGGAGCCGCTGTTTAACGAATCTTTTAACTTCTCAGTGTCCGGGATGACCTGGGCTCTGATTCGAGCACCGTTGAGGCGAAGAGTACAAGCAGCCACTCTTGAGGAGGACTTTGTGGAAAGTTCAGGGCCTGAAAAGAATTTGCGAAAAGCTTCTGTTGCTACGAGAAAGACTAGCGTGGTTTCAACGGGCGCTCAGCAAAGTTGTACAAATAAACAGGACCCCGATGGCACTAGCGGCTTAAAGCTTCAAACATTTTCAGGAAGAACTTCGCTTCAAGCAAAACATGACTCTGTAACCCCTTCGCCTAATATGCGACAACGTAAAATAAGCGTCAATACTCCGCAAGGAATGTCAGGAGGAACACGATTTTCACAACGAAAAATTTCGGCCCCGGCATTTTTCGCCAGGAGGAGTCCGGTCTCCGAGGACAGTAGCAAGGGTGGGTTTTTACCCGTCATCAAAACTCCAAACCCTCCACCCGAGAGCAGCAGTCCTTCGGTGAAAAGAAAATCGCCGCTACTCGACAGACCTTTGAGTGCAGCTAAAACTAACGAGGTCGATTTCCACACACGCTCGCCGGCTACGTCAACCCTGATGGTTCCCAGTAGGGTAGACACATCTCTGTGTAGGGCACGGTCTGTACCCCTCGAGCTGCCCTCATATCCGATGTCAACTGCGAGAGGTCGACGGCAAAGCGAAGCAGATGAGGTCGCCACGTTAACAATGGAAGAGACGCTTCGAATCAAAGGCAAATTCCGCCAAATTGGCCACTCTTGTATAGCCACCGCTTTGCTCAAAGGCTTAAAACAGAAAGGGCAGCTCTCGTCTGAAGCCATTCACAACATGCACAAACCGATTTGTTTAGGGGAGGGAAGTGAGACGCAAAATGAGGGCAATAAAGGCACTGATGAGTCGGCAAGCGAGTCGAAAGAAAATGATGGTGAAGAAGAAGCGATGAAACAAGGACATGGTAGACAGACGTTCAGAAATCTCGCCCGTAAAACAATCAATGTGAACAGAATGCTGAGTGTGCATAACTCTGCTAGAAGAAGAACAAAATCCGATCCCTCGGAAACCGATAAAAATAGCGCTGCAACTACAGCTTATTCACGACCAAAAACAGTTGCCAGTTCAACCAGAAAACACTCCGATAAAGGACTCGGGCAAGAGAAGGCCGATAATTCTGTTCAGCCAAAAGACTTTCGCGCAAATGGCGCCGGGCAGCGAAGGAGAGATAGTGTGACAGAAGTTCAACAAGATACCAATACACAAGATGGGAACGAAAGCGAGCACAATTCACAACAAATGTATAAAAAACAAAGCGGTGATGTTGATCCTCTGAGACCATTGATGAATCCACGCACAGCGCATGCGCGCAGAAGAAAGAACACATTGACTGGAGACATGATGGCCGACTTGATCGAAAAAGCGCAGAATGCCTCGGGAGATGCAAAGCCACAGAAACTCCATCCAGATGAACAAACAACTGGGAATAAATGTGTTCGATTTGCTACAGATGCGTGGAGTTGA

Transcript

OS493_013517-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P46097	Synaptotagmin-2 OS=Mus musculus OX=10090 GN=Syt2 PE=1 SV=1
Q8N9I0	Synaptotagmin-2 OS=Homo sapiens OX=9606 GN=SYT2 PE=1 SV=2
P29101	Synaptotagmin-2 OS=Rattus norvegicus OX=10116 GN=Syt2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000239 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00168 all species →	C2	C2 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR001565 all species →	Domain	Synaptotagmin	Interproscan
IPR047897 all species →	Domain	Synaptotagmins 15/17, C2A domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10024 all species →	SYNAPTOTAGMIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0000149 all species →	Molecular Function	SNARE binding	Interproscan
GO:0001786 all species →	Molecular Function	phosphatidylserine binding	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0005544 all species →	Molecular Function	calcium-dependent phospholipid binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0014059 all species →	Biological Process	regulation of dopamine secretion	Interproscan
GO:0017156 all species →	Biological Process	calcium-ion regulated exocytosis	Interproscan
GO:0017158 all species →	Biological Process	regulation of calcium ion-dependent exocytosis	Interproscan
GO:0030276 all species →	Molecular Function	clathrin binding	Interproscan
GO:0070382 all species →	Cellular Component	exocytic vesicle	Interproscan
GO:0071277 all species →	Biological Process	cellular response to calcium ion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_013517-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013517-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

13.3Max TPM

3.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.01	4.80
polyp at pH7 6	18	18	3.11	5.38
coral polyp · control treatment	16	16	3.98	8.67
coral polyp · oil and dispersant treatment	16	16	6.06	13.29
coral polyp · oil treatment	16	16	4.64	8.06
coral polyp · dispersant treatment	16	16	4.45	6.91
Polyp	10	10	1.76	2.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.80
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.21
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.84
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.72
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.57
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.56
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.53
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.00
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.85
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.76
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.59
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.50
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.48
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.42
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.17
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.06
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.06
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.97
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.38
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.19
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.07
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.53
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.50
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.48
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.37
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.36
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.12
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.05
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.86
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.72
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.71
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.64
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.46
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.25
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.09
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.27
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.67
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.55
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.48
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.47
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.27
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.05
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.18
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.37
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.14
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.99
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.92
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.72
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.64
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.45
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.15
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.69
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.29
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.46
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.42
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.98
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.96
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.37
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.37
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.87
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.69
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.27
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.87
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.82
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.90
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.69
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.67
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.28
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.06
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.84
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.22
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.52
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.48
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.41
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.12
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.84
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.59
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.99
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.65
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.35
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.76
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.74
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.66
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.96
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.91
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.49
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.93
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.65
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.38
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.18
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.17
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.97
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.87
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.51
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.39
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.34
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.72
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.64
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.06
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.02
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.48
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.20
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.04
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.04
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.98
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.87
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.69
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.28
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.27
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.72

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.