Gene detail

Detailed information of OS493_013543-T1 in Lophelia pertusa

Genomic Location: scaffold_37:862983...873755
NR annotation: KAJ7392171.1, Netrin receptor unc5c [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013543-T1

ATGCTCAATGCAACAAGTGCTGTGCATGTTATTAAGTATGTGGTGACGCACGAGTTTGGCCAGACAGCAAGCTGTGTATTCAACTTATCAGTCTACGATGACTCTTCCAGTGCCTGCAGTTTAACAAAGGAATGCAGGAATGTGAAGTCAACTAAACCAACAGCCAATATTTTGGCGGAACTTTGCCAGTCCCCCCTTCCCCCAGGCTGTAACATCGTGAAGTGCCTCAGTGATTCCCAAGTGATATTCTTGTCAGTGACACTAGTGTTAGTACTACTGGTGGTAGTAGCAGTCTTTCTGTTAAGATATGCGAATCATCATAGAAAATCAAGAAATCAAGAAATCAAGTTTGGTGCAAAGGATACATTGGACCATGCATCACATTTTGTCTGTCGGTCTTCATCTTATATTGAGCCTGCAACACCATCTGGAAAGCTGAAGGCCGCATCTCCCACTGAATCGGAAGTTTTTGTCTTCCCGGCGATGTCTGACGTCCCCGCACCATATAAAGAACTTAAAGTTGAACTTAACAATGAACAAAAGAGAGAGAAAGGTCGTGACTACAAGAGGACAAACTCTTCTGTCAGTAACAAGTCTACAGCATCAGAACTCTCTCGAATGATGTGGAACATGGTCAACATCCCAGAAAATGCTGATCCCAAGATGGTTGCGTGGGGACTGGTGGACCACAATGGAGGGAAATTTACTATAGGTAACACGGGTGTCAGTCTCACCATACCCCGACTGGCCATTCCAGAGGGTCGCACTGAAGGGATATACGTAGCTATAGTGGACCAAGAAAAGGAACATCCTCAGATAACTTCCAAGGAGTCACTGTTGAGTCCGGTAGTGAAATGTGGTCCAACTGGACTCAAGTTCCAACGCCCTGTGATCCTGAGTATGCCGCACTGCGCTCTTCTTGAGAAAGGAGCTTGGAATCTGAAAGTCCAGTATAATGAAAGTGAGCCCAGCACGACTGCAGACTGGAAGCAACTGATTGACGTCAGCAAACAGGATGGTACTGAGGCGTCCCATGTTGTAGTGGAACCGAACATGGTTCATTTGATGGTGGACCATTTCACAAGCTTTGTTGTGATTGGAGAGTCAGCGTCCAATCAACACGCCGAACGAACGCTGCTTATTCTAGCTTATGTTACACCTCCTGAGGCCGATAGAGACTGTGTCGTGAGGGTGTATTGTGTCGGAGGTACTCCAGCTGCAGTAGAGGATGTACACAATTACGAAACGACGAAGTATCGAGGAGAAACAATTGATCCACCGAAACAGCTTCACTTCAAGGATGGAGGAGGAGATCTCTTGGTGAAACTTACAGATCATCAACCGGGCTGGACAACCCGTTTGACCACAAAGAAAATCCTTTTCCGGGACATTTGGGAAGGCATTGAGCGTATGCCGAGTTGCACTTTTATATTCTCCTTGTCTGATACGAGTGTGTCTCGGTTTCGTGCCACATTTGAAGTGAAACAGAATTGTCAAGATGGCGGCGAACAGGAAGTCAATGTGGTGACGTCAGTCAAACAAGGACCAATCGTAAACCCAGACCCAAGAAACAATGTTGTCAAACAGCCCAACACTAACCTCACTTGTGCATGCAAAGCCTCGACAAGCTTCCCTCAGACTGTAAGTTCACCGAATTTAGTGGACCAGTCCACTGCCTTACTATATGCGGGATCGGGACAAATGTCTTCTGGCTACATATCTATTGGTTTTGAGTCCCTGCCAACTGTGCACTCACTGAGTCGCGAGTTACGCAGTAAACTTTCTGTAATCCTTGACCCCCCACACGAAGCCGATTGGAAAGTTCTGGCAGAAAATATTGGCCTCAGTAATAAAGACATTCGATGGATTGACAGCAGGAAAGCTCATTCCCCAACAGATACGCTCTTTAATTATTGGGAAATGGTATACGGTATGAAATGTCAATATCCTCTCCAAACATTAGCAGACATATTTCAGAAGATGGGCCGGGATGACGCAGCTAAGCTTGTTGAGGCTGAACTACTACCGCCAAGAGAAACGTCAGTTTAA

Transcript

OS493_013543-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7T2Z5	Netrin receptor UNC5C OS=Gallus gallus OX=9031 GN=UNC5C PE=2 SV=1
O08747	Netrin receptor UNC5C OS=Mus musculus OX=10090 GN=Unc5c PE=1 SV=1
Q761X5	Netrin receptor UNC5C OS=Rattus norvegicus OX=10116 GN=Unc5c PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004837 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00791 all species →	ZU5	ZU5 domain	Family	Interproscan
PF17217 all species →	UPA	UPA domain	Domain	Interproscan
PF00531 all species →	Death	Death domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000906 all species →	Domain	ZU5 domain	Interproscan
IPR011029 all species →	Homologous_superfamily	Death-like domain superfamily	Interproscan
IPR000488 all species →	Domain	Death domain	Interproscan
IPR037936 all species →	Family	Netrin receptor UNC5	Interproscan
IPR033772 all species →	Domain	UPA domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12582 all species →	NETRIN RECEPTOR UNC5	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0005042 all species →	Molecular Function	netrin receptor activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0038007 all species →	Biological Process	netrin-activated signaling pathway	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_013543-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013543-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

253.2Max TPM

64.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	28.30	48.98
polyp at pH7 6	18	18	27.65	47.10
coral polyp · control treatment	16	16	79.54	231.79
coral polyp · oil and dispersant treatment	16	16	98.78	214.02
coral polyp · oil treatment	16	16	79.37	214.53
coral polyp · dispersant treatment	16	16	116.65	253.24
Polyp	10	10	8.95	14.81

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.98
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.90
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.20
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.74
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.98
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.50
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.81
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.66
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.41
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.10
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.53
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.73
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.78
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.86
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.65
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.12
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.36
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.10
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.61
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.61
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.09
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.15
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.77
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.30
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.37
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.83
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.71
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.32
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.61
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.36
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.11
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.77
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.93
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.47
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.58
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	231.79
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	220.22
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	139.26
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	95.74
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	68.59
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	67.70
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.46
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	64.78
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.01
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.61
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.28
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.58
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.48
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.94
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.87
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.40
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	214.02
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	180.26
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	142.61
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	128.44
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	110.41
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	95.21
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.85
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	88.63
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	81.26
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	80.31
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	76.63
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	73.72
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.24
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.09
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.47
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.43
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	214.53
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	181.93
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	140.46
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	134.44
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	73.77
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	70.82
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	69.71
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.06
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.46
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.70
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.35
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.32
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.02
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.33
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.75
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.30
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	253.24
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	168.03
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	158.27
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	150.33
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	147.93
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	141.01
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	117.27
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	117.19
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	109.78
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	109.55
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	106.40
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	102.16
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	69.56
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	60.28
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.21
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.13
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.81
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	13.63
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	10.38
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.15
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.40
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.50
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.75
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.72
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.92
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.24

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.