Gene detail

Detailed information of OS493_013563-T1 in Lophelia pertusa

Genomic Location: scaffold_37:1449179...1464353
NR annotation: KAJ7392190.1, hypothetical protein OS493_013563 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013563-T1

ATGGACGAAGATATTTCTAGACATCGCATTGTTGTTCTTGGAGTTGATGACAACTCGGAATATGACGTGGAGTTCAAGACAGCTGCAGATGATAACGCCGGGACAGACGCCAATGTGTATTTCCAAATGATCGGCGAGGAGCGCGAGAGTCAAGAAATCCAACTCAACAACAGAGGAAAGGGATACTTTAACCGAGGACAACTGGACAGGTTCAGAGTCCGAGCTAAGGACGTTGGACGGTTGAAAATGCTGCGTGTAGGTCATGATAATTCTGGCTCGGATTCTCGGTGGTTGTTAGATGAAGTCGTTATCTACTCTTTGGCTCGTGGTGAGCGTTATGTGTTCAAAGGCGGCCGCTGGATCGGTGGAAGAAACAATGAGATCGACCTTCCACTAGATTCATGGAACTACGGGCAACTAGTTGGTCAGGAGCCGGATATTCCAGATTTAATTGATTTCATGCAGTCTGGAGACGAAGTAAAGATTATCAATGCTGCTGGATACTTGCAGCATTTGTGTTATAGCAAAGAATCCGTGAAGGATAAAGTCAGAGAGCTCGGTGGTATTCAAGTGATAGTCAGGTTATTGAGGCATTATGAATGGCGTGTCAGATATGCCGCCATCTGTCTCCTCAGGAATCTCTCGTTTAGTATGAAACACAACGCCAACAGGTTAGCTATAGCGGATTGTGGTGGAATTGAAGCTCTAATTGAAATCTTACAAGAAACGGAGAAGACAGAGTACAGAGAAGGAATTTTAGGAGTTCTGTGCAATTTATCGTCTGTTGAGTCGCTTCGTCTAAGAATCCTTCTCATATGTCTCCACATCATCGTCATCATTATCATCATACCGTACTCCGAGTGGACAGCTTTAGCGGCTCGCGAGCAGCCGCCTGTGAGGACCGAACCCTGGGCAGCGGTGCTCGTCCATGCTACCAGACTCGTGCGCAATCTGTCTTCAGCCGGTACCAGGGCCCGGCAGGAGCTCAGGGACGAGAAAGACTTGGTCGACTGTTTGGTGTGGATTACTAGAGTTGGTGTCAAGAATGAACAGTATGATAATAAGTGTCTTGAGCATTCTGTGTGCACGCTAAGAAACCTGTCATACCGGCTTGAAAGCGAGATTGACAGGGATCGTTATGATGACGCGGACGTTGACGTGGACCCCGCTGCAGTCAAGGAACAACAGAGCCAGGGCTGTTTTGCAGGGTGCGGTGACGTACAACAGTATCATATGCTGTTACGTAAATCCAAGAACATTGAAACGTTAGAGGGGTCAGCAGGAGCTCTGCATAACTTGACGGCTTGCTCGTGGAAGTGGGCGATCAAAATCCGTGGAGATACGAGAAGAGCACAAGCGATTCCACAGCTTGTTGAGCTCTTGAGAATCGACTACGACCCAACAATCCGTGCGGCAGCCATTGCTCTTCGCAACTTGTGTGTGGACTCTGAAAACAAGAGGACTGTCGGCGAGAAAGCGATAATCCACCTGGTCCACAGACTCCCGACAGGGGAGGAGGAGGAGCGACTTGTACGAGATCCAACAGTAGCCTCGCTTCTGTGTGCTATTTACCAGCTCACCAACAAGAACGACAAGAACTCCAAATATCTACGTAAGACGAAAGGTATTCAAAAGATGGTGAGAATAGCAACAGATCAGAACAAGCTGTACTCGCCGCGAGTCATAAAAATAGCCAATCAGGTTTTAGCGAATCTCTGGAGCCATAGCCAACTACAGCAACAGATTAAGAACGCAGGATGGCAATACGATGCTAACAAAAACGCCGAACTAGCTCGTGCGCCGATGGATTACGAAGGTACCTCCCTCCCTCAAACACCCGACGATCGGACCCGAAGAGATCCGAACAGTGCTCGATTGGAGAGCGACGACGATCAGTGGCGAGGCGGCAGTCGTCGGCCAAGGGACAACTGGGGAAATGTCAATGGAGGGACTGACATCTCTTCGGAATCAGATAGGCAACGTAGCTGGGGTGAAAGCTTGAATCAGATCCCCCCGCCGTACGCATCAGATGATAACTATTCCCGGGGGAGTCGGTCACGGGATGACCTCCCCATGGAGGTGATGTCGACCTCGTCGCGACCGTCAGCCGCGAATTCAGTGCGAGACGAGAATGACAACGCGAATGACAGGACGCTCAGGTTAAAGGACAGTGGGGGGTGGGGGTGGGAAGAACGAGGACCTGTGGGTGTAAGACTGTGGGGGAGGGTATGGTGTAACAATAAACAGGTTGTGTTTATACTTGCATAG

Transcript

OS493_013563-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q68FH0	Plakophilin-4 OS=Mus musculus OX=10090 GN=Pkp4 PE=1 SV=1
Q99569	Plakophilin-4 OS=Homo sapiens OX=9606 GN=PKP4 PE=1 SV=2
Q9U308	Juxtamembrane domain-associated catenin OS=Caenorhabditis elegans OX=6239 GN=jac-1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003887 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00514 all species →	Arm	Armadillo/beta-catenin-like repeat	Repeat	Interproscan
PF01477 all species →	PLAT	PLAT/LH2 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001024 all species →	Domain	PLAT/LH2 domain	Interproscan
IPR000225 all species →	Repeat	Armadillo	Interproscan
IPR028435 all species →	Family	Plakophilin/Delta catenin	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR036392 all species →	Homologous_superfamily	PLAT/LH2 domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10372 all species →	PLAKOPHILLIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0005912 all species →	Cellular Component	adherens junction	Interproscan
GO:0007043 all species →	Biological Process	cell-cell junction assembly	Interproscan
GO:0045296 all species →	Molecular Function	cadherin binding	Interproscan
GO:0098609 all species →	Biological Process	cell-cell adhesion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_013563-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013563-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

491.8Max TPM

120.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	82.99	128.85
polyp at pH7 6	18	18	74.78	128.23
coral polyp · control treatment	16	16	190.90	491.77
coral polyp · oil and dispersant treatment	16	16	126.35	229.64
coral polyp · oil treatment	16	16	145.96	274.26
coral polyp · dispersant treatment	16	16	156.67	421.25
Polyp	10	10	45.54	77.19

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	128.85
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	126.71
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	109.72
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	106.94
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	94.72
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	94.38
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	82.89
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	80.96
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	80.33
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	78.14
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	78.12
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	75.29
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	70.23
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	68.72
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	58.91
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.19
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.11
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.53
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	128.23
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	127.18
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	97.25
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	94.59
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	84.75
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	82.51
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	81.96
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	81.36
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	76.30
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	74.55
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	70.96
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	70.84
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	68.48
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	66.11
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.45
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.33
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.70
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.48
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	491.77
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	348.59
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	289.11
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	265.03
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	240.67
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	218.01
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	200.72
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	185.29
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	168.74
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	157.86
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	130.77
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	88.80
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	88.04
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	75.33
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	68.57
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.05
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	229.64
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	222.33
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	204.03
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	182.77
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	152.25
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	132.70
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	129.21
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	118.09
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	104.30
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	103.06
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	102.69
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	77.10
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	70.48
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.15
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.82
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	60.90
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	274.26
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	224.85
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	223.23
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	173.95
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	164.02
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	161.84
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	159.36
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	153.88
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	152.85
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	137.26
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	120.69
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	95.30
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	93.91
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	84.51
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	69.80
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.71
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	421.25
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	316.39
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	285.22
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	269.19
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	166.44
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	166.31
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	152.44
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	141.96
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	138.79
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	88.25
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	72.43
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	71.07
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	70.98
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	69.02
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.66
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.28
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	77.19
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	71.99
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	71.02
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	64.47
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	58.06
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	46.43
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	24.13
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	21.87
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	11.75
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.45

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.