Gene detail

Detailed information of OS493_013593-T1 in Lophelia pertusa

Genomic Location: scaffold_37:1839973...1869526
NR annotation: KAJ7392217.1, hypothetical protein OS493_013593 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013593-T1

ATGGCAGATCCATCTTCAGTCGTTTCAAGTGGAGTACAATCTTCAGTTACCAATGGGGACGGACAGATTGCAGAGGAGAGAGAGACCGTGGGCGAAGAGAGACCAGTCAACATACCGCGAAAATCAAGCGTTCTGAAAAAAGATGGGAGGCCTTCGAAACGATCACTGCAGAAGTCTGTCTCGTTTATTGCTCGGCCGGAGGATAAACGGATCATAAATGCGGCGGACTGTTTGACCTTCCTTCAGAATGGCTCGGAGCTAATGAAAATCCGTTCCAATTCACGGCAGTACCAGAGGTTCTTCTTTTTGGACGAAGACTTGACGGGTTTGCGTTGGCGGCCCTCCTCCAAGAAACCCGACAAAGCGAGAATTTCCATCGACACTGTGAAAGAGATACGCTGTGGGAAAAACACTGATGTCTTCCGTGACATGGACAGAGATGATTTTCAAGAAGATTGTGCATTTTCTATTATTTACAGTGACAGTTTTGAAACACTAAATCTTGTGGCATACTCCCCAGATGAGGCAAACATTTGGGTTACAGGTCTGAGGTGTCTTTTGGACTCAGATAAAGACAATGGAGGAAAAGGAAGGCTTAACGAGAAAGAAGTTCTTTCTGTGGTTAGAGAGCTCAATGAACAAATTCCAGAAAGTGTAATTAAACAGAGATTTAAGGAAGCAGTTGCTGTTAGTTCAAATTCTCAAAAGAGTAGTTTATCTAGGGAGGAGTTTCTTTCATTTTACAAAGAACTCACTACAAGACCTGAGGTTTATTTTCTTCTGGCAAGGTACACAAGCAATAGTGATTATCTAACAACAGATGATTTACTGCTTTTCCTGGAAGCTGAACAAGGGCTCTCTAGGGTGGGCAAAGAACATTGTTTAGACATTATCAAAAGATGTGAGCCGACAGAGGAAGGCAGAAGGTTAAAATGTTTAGGAATAGATGGTTTTACACAATATTTATTAGAAGAAGATTGTCATATCTTTGGCAGTGACCATAGAACAGTTTGTCAAGAGATGACTCATCCACTTTCTCATTACTTCATTGCATCCTCACATAACACGTACTTACTAGAAAATCAACTCAGCGGTCCGTCCAGTGTAGAAGCTTATATTGATGCACTTAGAAAAGGCTGTAAATGTGTCGAATTGGATTGTTGGGACGGTAGCAGTGATGATCCCGTTATTTATCATGGACACACTCTCACTTCAAAAATTCTCTTCCGTGATGTTTTAGAAGCTGTAGATGAACATGCATTCACAAAATCCCCATATCCACTTATATTATCCATAGAAAACCATTGTAGTGTAAAACAACAGCAAATTATGGCAAAATATCTGAAAGAAATTTTACAAGATAAGCTTTATACAATTCAACCAGGAGAAAATGAGTCGTATCTTCCATCACCAGAGGCGCTGAAAAAGAAAATTATTGTCAAAAACAAGAAGCTTCCATCAGATGTGAAGACAGACACTGGTGAGGTTAGTGATGATGACGACGAGCAAGATGACACAGTTGTGATGAATGGCGACTGTAAACTGGAGAGACAGAACAGTAAACAAGGCAGCTTTAAACGGCAAATAGTCAAGGATCCTAACAAAAAACCGAAGAAGACGATAAAGCTGGCACGAGAATTATCTGATCTGGTCACGTATTGTAAATCTGTTGCTTTCCAAGACTTCCAGTATTCCTCTGAAAACCAAAAATGCTGGGAATTGTGCTCGTTTAGTGAAAATGTTGCAAGACGGTTGACGCAAACATTTCCTGAAGAGTTTGTAAATTATAACAAGTCGTTTTTAAGCAGAGTGTACCCCGCTGGCAAGCGAGTGGACTCGAGTAACTACCATCCTCAGGAGATGTGGAACTGTGGCTGTCAACTGGTGGCATTGAATTACCAGACGCCAGGACTTATGATGAACTTAAACAAGGGGAAATTTCTAGAAAATGGAGGATGTGGATATGTCCTTAAACCCGCTGTCATGAGAGAAGAAATAGCATATTTTAATCCCAATACAAAAGATGTTATTCCTGGCGTCCCACCGCAAATACTGCAAATCAAGGTAATTAGTGGACAGCAGTTTCCCAAACCAAAAGGCTCAACAGCTAAGGGTGACGTGATCGATCCGTTTGTCACAATCGAAGTGTTTGGTATCCCAGCTGACATATCACAGGAAAGAACAAGAACTGTTCCTCATAATGGTTTTAACCCCGTATTTGACGAAACCTTCGAGTTCCACGTCAATCTTCCTGACCTCGCCCTAGTGCGGTTTGTAGTGCAGGATGATGACTTTATCGGTGACGGGTTCATCGGACAGTACACTATTCCACTCAACTGTATCCAACCAGGCTACCGCCACGTGCGTCTTCTATCATCGCAGGGGGAGGAGCTGGAATCAGCCACCTTGTTTGTACACGTGACCATCACAAACCTCAACGACGCTGTAGCTGTAAGTGTTGTACGTGCAAAGACCAAGGAAAGCCTCCTTGAGGAAGTCGAAGAAAGCGAGGGAGTACACAAGTATGAAATCCGTGGGGTTAAAGCTGTCGATGATACGTTTAAGGTGGCTATTCAACCCCTCAGAGATGGCACGGATCTTAGAGAAAATGTCCAAACAGCTCTTGGGAATTTCAGGGAGATCTGTGGCGTGGCCCCCCGGTCAAACCTTAAGCAGTGCATACGGCTATTGGCTTCCAGATTAGAAAGCACTTCAGAGTTTCTCGCTTTGAAGCTGGTCATGAAGGATGAGTATCCTTACTTCGAAGCTCATGGAAGTTTGCCTGAGATGTTAAAGAAAGCGCTGGCAGCTATAGAGCAGGTTGTTCAAGATTCCAAAACGTTAATCGAAACGTGTGACTCCGTGCACGAAAGGATTATTCAGAGTGAGAGAGCTGGACTGGAGTGGCATGAAGAACTACACAGTGCTTGTGTTAAAGAAGGAATTAAAGGCAAGCGATTATCAAAGGCGGTTGAAAGCTATGCGTGGAACATCCGGGTCTTAAAGGGCCAGGCAGACTTACTTTTAAACGCAAAAAGTGAATGCCAGGAATACCTTCGCCAGATTCAAGAGGCGACTTTAGCTTCTGGTCTTGTCAAGTCCGTTGGTTGTAATCTCTGA

Transcript

OS493_013593-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q15111	Inactive phospholipase C-like protein 1 OS=Homo sapiens OX=9606 GN=PLCL1 PE=1 SV=3
Q3USB7	Inactive phospholipase C-like protein 1 OS=Mus musculus OX=10090 GN=Plcl1 PE=1 SV=3
Q62688	Inactive phospholipase C-like protein 1 OS=Rattus norvegicus OX=10116 GN=Plcl1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000754 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00388 all species →	PI-PLC-X	Phosphatidylinositol-specific phospholipase C, X domain	Family	Interproscan
PF09279 all species →	EF-hand_like	Phosphoinositide-specific phospholipase C, efhand-like	Domain	Interproscan
PF16457 all species →	PH_12	Pleckstrin homology domain	Domain	Interproscan
PF00387 all species →	PI-PLC-Y	Phosphatidylinositol-specific phospholipase C, Y domain	Family	Interproscan
PF00168 all species →	C2	C2 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR000909 all species →	Domain	Phosphatidylinositol-specific phospholipase C, X domain	Interproscan
IPR015359 all species →	Domain	Phosphoinositide-specific phospholipase C, EF-hand-like domain	Interproscan
IPR001711 all species →	Domain	Phospholipase C, phosphatidylinositol-specific, Y domain	Interproscan
IPR001849 all species →	Domain	Pleckstrin homology domain	Interproscan
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR017946 all species →	Homologous_superfamily	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain superfamily	Interproscan
IPR001192 all species →	Family	Phosphoinositide phospholipase C family	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10336 all species →	PHOSPHOINOSITIDE-SPECIFIC PHOSPHOLIPASE C FAMILY PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004435 all species →	Molecular Function	phosphatidylinositol phospholipase C activity	Interproscan
GO:0006629 all species →	Biological Process	lipid metabolic process	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0035556 all species →	Biological Process	intracellular signal transduction	Interproscan
GO:0008081 all species →	Molecular Function	phosphoric diester hydrolase activity	Interproscan
GO:0048015 all species →	Biological Process	phosphatidylinositol-mediated signaling	Interproscan
GO:0051209 all species →	Biological Process	release of sequestered calcium ion into cytosol	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15370	PLCL2; inactive phospholipase C-like protein 2	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013593-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

62.8Max TPM

18.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	20.04	31.39
polyp at pH7 6	18	18	17.44	27.57
coral polyp · control treatment	16	16	21.77	50.51
coral polyp · oil and dispersant treatment	16	16	13.79	46.29
coral polyp · oil treatment	16	16	22.44	62.80
coral polyp · dispersant treatment	16	16	16.00	43.13
Polyp	10	10	15.20	29.23

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.39
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.14
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.25
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.16
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.33
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.97
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.46
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.69
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.73
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.44
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.79
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.04
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.76
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.59
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.22
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.46
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.08
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.11
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.57
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.46
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.82
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.67
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.90
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.38
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.91
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.03
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.29
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.89
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.25
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.11
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.57
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.17
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.09
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.65
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.13
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.51
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.13
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.21
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.21
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.56
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.35
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.58
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.77
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.55
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.36
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.93
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.85
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.57
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.13
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.13
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.48
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.29
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.15
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.97
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.95
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.45
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.31
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.02
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.37
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.15
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.82
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.43
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.10
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.77
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.17
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.95
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.69
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	62.80
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.85
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.74
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.62
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.65
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.84
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.20
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.93
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.78
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.31
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.11
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.06
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.17
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.59
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.17
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.21
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.13
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.58
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.09
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.80
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.52
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.96
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.45
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.97
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.18
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.39
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.88
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.84
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.95
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.18
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.05
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.03
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	29.23
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	22.54
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	21.35
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	18.55
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.21
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.62
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.40
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	10.34
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.78
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.03

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.