Gene detail

Detailed information of OS493_013598-T1 in Lophelia pertusa

Genomic Location: scaffold_37:1921979...1949649
NR annotation: KAJ7392222.1, actin polymerization-dependent cell motility [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013598-T1

ATGTCCCTAGATCCGTACAACTATGGAAATGACACTGCCTGGGCAAATCATAATGGAGCTGAGTCTAAGAAAAAACACAAGAAAGGAAAGGCTCACAGAGCAAGACAATCTGTCACATTTGATTTAACACCAATTAATCTTGGTCTTGACAAGGGAAAGTCACCAAGTATGACCAATGGAGCCGGTCCTAGAAGATCCCCCAAGAGCTCTCCTAATTTGGGACCGCGCAAAGATCAGAAGAAAGTGCCTGTCCAGTTTGCAAGCCAGTTTCCTGCAAGAACGAATTTTCTTCTGGAGCATCTATCATCTTTCACTTTAAAAACAGCTCAAGAATCTCAAGTTCCTGCTCAGGAAAGACTTAAGCAAACTAAGGAATTGTTAGCCAAAGGCAATCAATGGACGAAAGAGATGGAGATGAGATTGACGGACACTGATATAGTGCTTTTAGATGGGGAGACACAGGATGTTGTTGAAGTGTTCTCATTGAACACAATTGGCCACGTACATCACTTCAGTGATGACCCCGACTTGAACAGCGTGTTGATATTCAACACACTGCAGACAGAGGACAAGTTTGCTGCTATGCATCTGTTCCAGTCAGACAGGGTGCCGGCAGCAGTTGTAGCCACAGAAATCATGAAAGCCTCCAGCAGCAAAGCGGCAATGCCCAGTAGATATGCATCAAGAGGTGGTGTTATTCTACCACCACCCCCTACTCATCCAGCGCCCCCTCCCCCCACGGAAGTTGATCAAGAAAGGTTAGATCTGTACGAGAAATCGCTGGTGGCTCAAACCATTGCAGCATTTTCTGCAGTGTCTGATAACAGCACAAAGAAAACTGCAAAACCACAAGTATCTTCTAAATACCAGGCATCAGACTCTTCCTCTGATATTCCTGATGAAACACTGTCTGCTGAACTGTTGGAGGGTCGCACTAACAGAGAAGTGCAAATCTTGAACCACTGTATTGATGATATTGAGAACTTAGTCATGAAAACAAAGAGGTCGGCTGAAGCCTGGAAAAAGCTGCAGAAAAAGAAAGGAAAAGTTAAACAAAGTTCTTTGACCCTCGAAGCTCGACCACCTCCGGAGGCAGATTTCTATGATGCATTTCAAAAATTAAAGCATGCCTTAAACTTGCTGGCCAAGTTGAGGCAGCACATTCACAATCCTAATGCCGCTGAATTGGTTCATTATTTATTTGTTCCTCTCTCTTTGTTGATTCGTTGTACAGGAGGTCCTGACAAGGCCAGAGCAGTTGTTGTCCCTTTGCTTACTTCTCATACTATAGATTTGCTACAGAACTGTCTCTCATCTAAGGAAACAGAATTTTGGATGTCTATGGGACCCAACTGGACATCAACAAAGTCAAGCAAACAGTTCAAGGATCAGTTTATTCCTCCATACAATCCAGTGTTTAAGGATGGCTGGCTGCCACCAGAGGTGATTGCTGGTAAAGATGTGTCCAACCTTAATGCCGTCATTGCTGCTAATGCTGCTAATGCCGCAGCTGTGGCTCAATTGACTGATGGACAGAGAAAGGGTGATGATTCTGCTGCAAACCTAGCAAATCCAGCTGTGCTCTCGGCAGCAGCCAAGTTCAGACGACTCGCCAGTGTGAAGAAACCAGGAGAATCACCACCACCAAGCCCACCCAAGAAAGGCTTGAGAAGGGTTCGAGTTCTTTATGACTTCCAAGCAAGAAACAGCAAAGAACTGACAGTTAACCAAGGAGAAGAAGTTGCTGTTCTTCTTGATAATCGGCAGTGGTGGTGCGTCAGAAACTCAGAAGGCTCGATAGGTTTTGTACCAAATACAATAGTGGAAGAAACAGTGGTCCTTCCCAGTCCCCCGACAACAGCTCCTCCGCCTATCCCAACAACACAGGTGACGTCATCTCAGACAGTGGTACAGCGAAATGAGACCACAACCCAAGCATCTTCACCATCGCCACCAGCCCGAGTCTCTGAGAGTCCAAAGATTCCTCATGTGGAGCTACGCCCTGTTGGACTGACCAAGCCAAACCGTCCCGTCTCCGCACCTCCTACACAACTGGTGATACCTCCTCCTCCTCCGAGCAGTCCACCCCCTGCCTCCCCTCCCCCACCCGCCACACCTCCTCCCCCTGTACGTTTGAGGACGAAGGACACTATACAAAAAGAGAAAGAAGCTACCCTCCCTGGAGGCGCAGACTTTGCCAAGGCCATCCAAACAAAGAATCTCAAAAGAGTTGATCCTGAAGAGGAAAAGAAACGACGCGAGCAGTCCCAACAGCACAGAATGAGCTCAACGGATATGTTAAATGATGAACTCAAACGAAGGATGACTTCCACTCAGGGGGGACTCACACCCAGGGGACAACGGAAGGATTTGCAGTCAGTTAATCTGAATGCTGATTCAAATGCTGTTGAAGTCAAGGAATGGTTGAAGAGTAAAGGTTTCAGTTATAGCTGTGTGTCAGGGTTGTCTGGCAAGTCCGCTAAAGATATGGAGTCCATGACAAAGGATCAGTTGAAGCAGGCTTGCGGTGAGGCTGATGGATCCAGGGTGTTCAGTCAGTTTGCGGTGCAAAAGGCCAACTGGAAGGTGACGAATAAAGGATCTGAATTAGCGTTCATAATGCAAAAACGCAAGGAGCGTACAGAAGAGAAAGCGGACGAGGAACCGGGAAACGCCGGCGAGCTTCGCAGCATTGTCGCTGACGCCAAAGCAGTGGCTGCCCAAGAGGAAACCGAGTTCAGAAAGAGAACAGCAAGCGCGGGGCAGAAAGCAGCAGTTGAGCTTAGTGTCCCACAACCAAAACCTCGCCCCAAGAGCTTTGCAGGGCCTGACACCAGTGTCGAAACCAGGCCACGCACGAATAGCAAGACACAACGCAAGTCGTCCCGAGGGACGTCGTTTGAAGGCGAGTTTATCCCGCCGCCACCGCTGGATTCCGAAGATTATCCGACAAGCGACGAACAAAGTCCGAGGGCGAGAAAGATTTCTTCTGAAGACGTGGAAAACATTATGAGAGAACAGAAGAAACAGCAGGAACTAATATTGGAACACGATAATCAGTTATTCCTACTTGAGCAGCTTCAACGACAAAAGCTAGAACTGGAACAACAGAAACGAGAGTTTGAAGAACAACAGCAGAGGCAGAAACAGGTTGACTTACAGGATCAGCAGAAGGAGCTTCATCGTCAAATCCAAGCGCAACAAGATCAGTTGAAAATGAACCAGGACAAACTAGTCCAGCAACAACGTTTTCTTTCTAACTACGAGACGATGCCTCCACAGTTCACGTATGCTCAGATGCCCCCGGTCATGCCTCAGATGCCTGTCATGCCCCTTGCGGGCGTCCCCACAGGGGCTCCCGCGTATCTTCCAATGGGGGGCCTTCAGCCCATGTACACACCTTATCCTACTATGGCCCAACCCGGCGTGACACATATGGTACCTACCATGGGTATGAACCCGATGACGCCTATGCATAGCAGAGCTGACAATACAACTCTGTAG

Transcript

OS493_013598-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
F1M3L7	Epidermal growth factor receptor kinase substrate 8 OS=Rattus norvegicus OX=10116 GN=Eps8 PE=1 SV=2
Q5R4H4	Epidermal growth factor receptor kinase substrate 8 OS=Pongo abelii OX=9601 GN=EPS8 PE=2 SV=2
Q08509	Epidermal growth factor receptor kinase substrate 8 OS=Mus musculus OX=10090 GN=Eps8 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002377 (this species only)
Ubiquitin family	UBD\|Other\|SH3 · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00018 all species →	SH3_1	SH3 domain	Domain	Interproscan
PF08416 all species →	PTB	Phosphotyrosine-binding domain	Domain	Interproscan
PF18016 all species →	SAM_3	SAM domain (Sterile alpha motif)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR039801 all species →	Family	Epidermal growth factor receptor kinase substrate 8-like	Interproscan
IPR013625 all species →	Domain	Tensin/EPS8 phosphotyrosine-binding domain	Interproscan
IPR041418 all species →	Domain	SAM domain	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR035462 all species →	Domain	Eps8, SH3 domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12287 all species →	EPIDERMAL GROWTH FACTOR RECEPTOR KINASE SUBSTRATE EPS8-RELATED PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0003779 all species →	Molecular Function	actin binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007266 all species →	Biological Process	Rho protein signal transduction	Interproscan
GO:0035023 all species →	Biological Process	regulation of Rho protein signal transduction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17277	EPS8; epidermal growth factor receptor kinase substrate 8	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013598-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

74.4Max TPM

36.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	31.75	55.08
polyp at pH7 6	18	18	29.56	43.93
coral polyp · control treatment	16	16	50.32	74.39
coral polyp · oil and dispersant treatment	16	16	40.53	56.47
coral polyp · oil treatment	16	16	43.35	71.30
coral polyp · dispersant treatment	16	16	36.03	55.49
Polyp	10	10	15.99	26.57

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.08
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	53.63
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.93
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.59
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.60
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.87
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.49
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.70
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.83
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.67
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.12
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.93
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.06
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.68
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.77
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.60
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.80
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.25
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.93
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.35
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.08
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.80
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.88
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.40
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.62
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.20
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.72
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.22
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.06
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.39
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.68
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.64
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.49
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.17
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.15
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.26
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.39
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	72.80
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	71.42
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.93
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	60.29
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.81
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.54
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.83
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.42
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.11
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.78
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.39
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.30
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.12
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.01
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.94
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.47
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.73
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.59
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.50
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.90
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.55
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.69
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.65
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.49
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.01
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.62
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.61
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.89
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.57
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.89
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.36
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	71.30
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	69.54
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.77
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.40
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.50
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.95
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.69
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.17
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.32
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.81
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.30
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.95
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.65
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.31
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.97
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.02
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.49
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.39
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.90
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.44
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.26
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.17
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.26
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.50
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.55
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.47
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.13
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.12
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.93
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.50
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.90
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.53
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	26.57
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	24.39
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	23.45
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	21.81
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	20.22
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	12.62
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	10.29
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.22
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.73
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.56

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.