Gene detail

Detailed information of OS493_013620-T1 in Lophelia pertusa

Genomic Location: scaffold_37:2181797...2192848
NR annotation: KAJ7392242.1, hypothetical protein OS493_013620 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013620-T1

ATGGGCGATGTGCTTGGAGAAGGAACAGAAGGAAATGTGTTTATCCAACTGTTTGGTGACAAGGGTATGACAGAACAGATACAACTACGGCAAGCTGGAAATTCAAAGATATGCTTTGAGAAAGGAAGAACTTACAAGTTCACTGTTGAAACAATTGATATTGGAAAGATTGACAAAGTAACTGTTAGCCATGACAGTCAGCAGCCCACTGCTGGGTGGTACTTGGAGGAGGTTACTGTTGATGTGCCATCACGTGGTGACCATACTGTGTTTCCCTCGCACTGCTGGTTAGCTCCAAGCCAGGGCGATGGAAAAATTTCCAGAGACTTTGCATCAAGGCCTTGTCTTTACCACCTGGCCATTAAAACAGGGGATGAGAAAAACGCTGGCACAGATGCGAATGTTTGGGTTCAAGTTTACGGTGATAAAGGCGACACTGGGCATGTACAGCTCAAGAAATCAGGAATGATGGAGAACCTGTTTGAACGTGGCCAGACGGATTACTTCACTTTGGAAGCTGGTGATGTTGGAAAGATCGAGAAGCTTCGTGTCGGCCATGATGGGCGTGGTGCCGCAGCCGACTGGTATGTAGAGGAGGTGATATTAAACAGCGCTGTCAGGGGGGAGCACCTCATCTTCCCGTGCCATGCCTGGGTGGCAGAGGAACAGGGTGTAGGATATGCAGACAAGGAGCTGCATCCAAAACAACCTGTTTCTGATTATAGCGTGAGGATAAAGACAGGGAGCGTGAAGAATGCCGGGACAGACTCGAACATTTACATTCAGGTGTTTGGTGATAAAGGCGACACTGGAGTCATTGAACTCAAACAAATTTGTGACACCAAAGACAAGTTTCAACGAGGAATGAACACAAAGATTAACTTGCAAACTGTAGATGTGGGAAATCTAGAGAAGGTGCGTGTCGGCCATGATGGGCGTGGTCTTGGGACAGGGTGGTACCTTGAGGAAGTCGTGATCATTATTCATGACGAGTGCTGGATCTTTCCTTGTAATCGCTGGCTGGCTGATTATGAAGATGATGGCAAAACCGAGAGGGATCTGTATGCAGAGAGAAAGACTTACGCGCACGAGCCTGACCTACAGGACTTGATAGAATACTTACAAACTGATGACGTCACACTCATCGTGAACGCTTCCAATTATCTGCAGCATCTCTCGTACAGCGACGAGCAAGTCAAGGTCAAAGTTCGAGAGCTTGGTGGGATTCCAATATTGGTTCGTTTGCTTGATCATGATCTGGAAGAGATTCATCGCTCAGCTGCGGCGTGTTTAAGGAATTTATCCTATAGCAAAGCAAGGGACGAGAACAAGTTGGCTATTGCAGAATGTTATGGTATTGAAGCTTTGGTAAAGGAAGTGGTTTTGGGTGTTTTATGGAACCTGTCTTCTTGTGAAGATCTCAAACTCCGCATCCTGGAAATCTGCCTGATAGTAATGGTGACTATTATCATCATTCCGTACTCTGGCTGGAGCAGAGCCGCTGCCGATAGTACCGCTCCCCTGCCGTCAATAAAATGGTCCACAGTGTTCCGCAATGCGAGCGGTGTGCTGAGAAACGTGTCCTCGGCTGGACCAGAGGCGCGGCGAGTAATGAGGGACTGTGATGGACTTGTGGATTCCTTTGTGTGGATCATTAAGGCGCCTATTGGCAAAACTGATATCGATAATAAGGCTGTAGAAAACTCCGTGTGTATTCTTCGCAACCTGTCATATCGACTCGAAAACGAAGTGGACAGAGAAAGATACAAAGATGCCCCTGTACCCACTCAACCTGGCAAAGAGAAAGAGCTGGAAAAACATGACCCGGGCTGTATGGCGGGATGCGGGACAGCGTCAAAGAAGAAAAAGAAAGGAATGCTCAGAGAAAAGGAAGAACCGCAAATAAGCAAGGATCCTCTTGTGGAGGGAGTGGAGTTGTTATGGCAACCAGAGATAGCCAAGTCATATCTGTCAATCATGGCGGAATCAGCCAATCCCGAGACGTTAGAAGGGTCAGCGGGAGCGATACACAATCTAACAGCGTGCGGCTGGAGGTGGTCGATGATGATTCGTTCTGCTGTGCGGAAGGAGAAAGGTCTTCCCATCTTAGTGGAACTTTTACGAATGAATCACGACCCTGTAGTAAGAGCTGTATCCACGGCGCTTAGAAATCTTGCAATTGACCCGCGGAACAAGGATCTTATAGGTAAATACGCCATTAAGGATTTGGTTCACCGTCTTCCTGATCCTAACTCACCCAATGAAAGAGCAGACGAGAACACGGTCGGTGCAATCTTGTGCGCCATACATCAAGTGGTAACAAGAGTATAG

Transcript

OS493_013620-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9UQB3	Catenin delta-2 OS=Homo sapiens OX=9606 GN=CTNND2 PE=1 SV=3
O35927	Catenin delta-2 OS=Mus musculus OX=10090 GN=Ctnnd2 PE=1 SV=1
B4F7F3	Splicing regulator ARVCF OS=Rattus norvegicus OX=10116 GN=Arvcf PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002240 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00514 all species →	Arm	Armadillo/beta-catenin-like repeat	Repeat	Interproscan
PF01477 all species →	PLAT	PLAT/LH2 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR000225 all species →	Repeat	Armadillo	Interproscan
IPR001024 all species →	Domain	PLAT/LH2 domain	Interproscan
IPR036392 all species →	Homologous_superfamily	PLAT/LH2 domain superfamily	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR028435 all species →	Family	Plakophilin/Delta catenin	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10372 all species →	PLAKOPHILLIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0005912 all species →	Cellular Component	adherens junction	Interproscan
GO:0007043 all species →	Biological Process	cell-cell junction assembly	Interproscan
GO:0045296 all species →	Molecular Function	cadherin binding	Interproscan
GO:0098609 all species →	Biological Process	cell-cell adhesion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_013620-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013620-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

51.5Max TPM

27.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	24.78	38.78
polyp at pH7 6	18	18	22.95	31.66
coral polyp · control treatment	16	16	38.57	51.49
coral polyp · oil and dispersant treatment	16	16	26.00	38.37
coral polyp · oil treatment	16	16	33.03	50.99
coral polyp · dispersant treatment	16	16	30.80	50.48
Polyp	10	10	14.78	25.09

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.78
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.54
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.55
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.44
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.69
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.47
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.16
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.85
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.48
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.21
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.02
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.89
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.76
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.23
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.02
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.43
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.36
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.18
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.66
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.93
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.20
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.21
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.69
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.74
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.54
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.10
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.88
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.06
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.37
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.25
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.24
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.13
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.59
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.22
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.35
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.49
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.53
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.21
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.10
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.83
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.82
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.94
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.13
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.54
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.32
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.42
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.94
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.57
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.91
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.06
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.37
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.37
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.08
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.73
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.78
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.20
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.04
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.93
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.98
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.26
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.53
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.43
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.35
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.58
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.76
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.28
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.63
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.99
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.45
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.41
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.43
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.19
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.63
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.51
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.11
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.55
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.77
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.75
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.37
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.90
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.19
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.39
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.84
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.48
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.62
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.47
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.31
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.57
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.53
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.41
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.36
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.11
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.17
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.16
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.07
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.27
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.12
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.73
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.36
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	25.09
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	22.27
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	21.18
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	19.47
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	17.60
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.58
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	9.91
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.57
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.83
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.28

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.