Gene detail

Detailed information of OS493_013677-T1 in Lophelia pertusa

Genomic Location: scaffold_38:109541...121645
NR annotation: KAJ7385651.1, MORC CW-type zinc finger protein 3 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013677-T1

ATGTTTAAATATAAAGAGGAACTTTTAGCAGAATTTTACGGGATTCAAAATCCCAGTGGCACTCGTATTATAATCTTCAATGTGCGAACCACTCCTGATGGCAAACCAGAGTTTGATTTTGGAACTGCGCCTGATGATATAAGAGTTCCAGAGGACACAGACTCGGAGGTCTGCAAAATTCAGAGACAGGAGCGACAAAACCACATCCCAGAGTCAGATTACTCTCTGCGGGCATATTGTGCGATTTTATACCTGAGACCGAGAATGCAGATTCTACTCAGAGGTAAAAAGGTGCGCACCTCTGTGATAACAAAGAGTTTGAGTAAAACAGCTGTGGATTTCTACCGCCCTTATGTGCGGGAAGTTAACCCAAGCTCAATGGGAAACAAACCAGTAAACAAAATAACATTTGGCTTTAGTCAGAATAGAAATCATTACGGAATTATGTTGTACCACAGAAACAGGCTGATAAAACCTTATGTCCGTGTGGGTTATCAGTTACGAGCTAATAACTTTGGAGTCGGAGTTGTCGGTGTCATTGAATGTGATTTCCTTCAGCCGACTCACAACAAACAAGATTTTGATTACACCAAGGCTTACAGAGCTTGCATTGCTGCACTGGGATCCAAGTTGAATGATTACTGGAATGAAAAGAAAGGTCCTCAACGAGCCAACAGCGAACCAATCCCTGAACCTGTGGAAGTTCAACAACTCCCTGACCAGACTTGGGCGCAATGTGACTATCCAGAATGTTTAAAGTGGCGCAAGTTACCCGTAGGTACAGACCCTGATAAGCTGCCAGAGAAGTGGTACTGTAAGGATAATCCCAACCCAAAAATGAGGTCTTGTAGCATCCCCGAGGAGAAGGAAGAAGAAGTTGATCAGCCATATGTCAAGACGCAAAAGAAACGCTTGGAAAAAGAGTTGGAGGATAGAAAACGCAAGGAAAAGGAGGCGGCACAAAGACAGGTTGACGAGGTGGGCAAAAAGGTTGGAGCAACAACGGAAAGACTTAGAGAAAAAGAAGCTGAACTACAGAGGTTGAAAAAGCAGCTGTCTGAAATTGAATCTGGAAGGGAATCATCAATTTTGCAGTCAATCGAAAAGAACAGCGTCAAGCAGCAGTATGCTATAAGACAGCAGGTTAAAGGGGAGCAAAAGTCACCTCAGCCATGGCGAATAAAGGTAAACAAAGCTTCTTTATTGAACTCACTTCAGTTGGTTACGCCATCTTCAAGTGCGTTCAAGCCAACAGTACGACCTCGAACCACACCGACACTGGCTCCTCGTAACATTCTGGTATCCAACAATTCAAAGTCACCAGTGATTTTAACACCAAACCGAAACCAACAACAGCAACCATCAGTCAAGGTTCTCAAATCCGCTTACTCAGTCATTCAGCTCTCCATTGAGATCACCTGCGATGCCGTCCAGTTACAAACCGCTAGAGTCATTACAAGAGGTCAACAGGCAGGCCACACAGCAGTCATCAGTAGTCCCCCTGTGTCCGCAGTTCTCCCAGAGGCTAACGACTCCACCAAGCAGTCGCCCACTGAGCTCAGGAACCAAGTGACTGTCCGCGACAGATACCGATACATTATCCCCCTGCCACAGACTTCAATATCATCCACGCCAGTGCCTACCACTGCAGCTGGCTCCAGCAGCACCCAGCTTATTCCGACATCACCTGTCAAGCCTGCAATGCCAGTTGCAATGCAACCCATTGCTTCTGCAATCAACCAAGTGTTGCAGGCCCAGATTAAACAGGAATCAAACGGTCCTGTAGTGCAGGCTGCCAACTCCTTACAAACAGGTCCACATATTCAGATAACCCAGGTGCATTCTGGGGGCCCAGCAGTGGCAGCGTCAACTGGCCTTTCTGTTAAAGTGAAAACTGAGAAAGTTGAAAGGCCGCTACTGGTGAACGGCATCAAGCGAGCACACGACAACGACGATGACGTCATAGAGCAACCAGTCGCCCAAAAACCACGCGTGGAGAAGGAAGTAATTATCATCGACTCTCCACCCCCTCCCCCAGACTCTCCTCTACCCCCTCCCCAAGAGGAAAACACACTCGAACCGTCAGTGGCCAATGAGAGTGAACTCGCTTTAGAAGGAGTCGATAACGACTTGATAATCAAACTTGGTAAACTTAGTCGTGAAGAACAGTGGAGCAGACTGGCGCACTCCGCTCAACAGCTGAGAAATCTGCGTGACAATGTCTGCAAACTCTTGCGTGTGCTGGTACCGGAGATAGAATTGGGCGACAAAACCGAAATACTTGATGACACGACTGTGGATAATCTTTTGAAACAGGTGTTGGAGGCGAATCTGCATCCCAACGCGACACAATCATAG

Transcript

OS493_013677-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q14149	MORC family CW-type zinc finger protein 3 OS=Homo sapiens OX=9606 GN=MORC3 PE=1 SV=3
F7BJB9	MORC family CW-type zinc finger protein 3 OS=Mus musculus OX=10090 GN=Morc3 PE=1 SV=1
Q8TE76	MORC family CW-type zinc finger protein 4 OS=Homo sapiens OX=9606 GN=MORC4 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003253 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17942 all species →	Morc6_S5	Morc6 ribosomal protein S5 domain 2-like	Family	Interproscan
PF07496 all species →	zf-CW	CW-type Zinc Finger	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011124 all species →	Domain	Zinc finger, CW-type	Interproscan
IPR045261 all species →	Family	MICRORCHIDIA ATPase family	Interproscan
IPR041006 all species →	Domain	Morc, S5 domain 2-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23336 all species →	ZINC FINGER CW-TYPE COILED-COIL DOMAIN PROTEIN 3.	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0035064 all species →	Molecular Function	methylated histone binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24135	MORC; MORC family CW-type zinc finger protein	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013677-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

62.5Max TPM

18.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	15.86	23.73
polyp at pH7 6	18	18	15.27	21.73
coral polyp · control treatment	16	16	17.99	29.70
coral polyp · oil and dispersant treatment	16	16	23.14	44.62
coral polyp · oil treatment	16	16	14.08	23.57
coral polyp · dispersant treatment	16	16	28.77	62.53
Polyp	10	10	12.36	19.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.73
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.31
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.34
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.59
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.64
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.12
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.31
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.29
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.95
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.91
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.07
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.98
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.78
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.63
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.23
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.91
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.56
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.20
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.73
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.36
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.91
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.74
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.54
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.28
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.39
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.24
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.88
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.25
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.10
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.58
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.98
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.16
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.34
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.32
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.83
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.21
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.70
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.49
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.48
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.32
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.82
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.28
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.80
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.64
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.54
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.33
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.73
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.63
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.78
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.11
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.47
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.76
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.62
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.73
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.23
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.81
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.70
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.59
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.50
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.17
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.69
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.67
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.66
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.72
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.90
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.38
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.37
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.44
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.57
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.43
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.32
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.92
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.89
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.85
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.97
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.57
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.16
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.44
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.40
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.26
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.10
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.49
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.17
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.67
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	62.53
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.33
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.28
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.15
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.77
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.35
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.40
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.13
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.89
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.38
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.13
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.69
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.53
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.16
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.34
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.25
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	19.48
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	18.82
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	16.38
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	14.93
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	14.33
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.06
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.12
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.96
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.48
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.05

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.