Gene detail

Detailed information of OS493_013819-T1 in Lophelia pertusa

Genomic Location: scaffold_38:1558485...1586606
NR annotation: KAJ7385785.1, hypothetical protein OS493_013819 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_013819-T1

ATGGATTGCCACGAAAGTGTTTCAAGAAACTGGCAGGAGCTGGACTTGGATCTTGAATCCAAACTTCCTGATGACGATCTCTGTCGATTACCCTCGTTGTCAGAGCAAACGTTGCTCGAACATTTGGAGGAGAGGTTTTCCAAAGGAAGGATTTATACTTACGTGGGAGAAATACTCATCACCGTGAACCCATTTCGCTTTTTTCCTATGTACAATCCAAAGTTTATCAATGCTTACAATAACCGGAACTTAGGATCGCTACCTCCTCATATTTTTGCTATCGCCGATGTGGCGTTTCATCGCATGTTGCGAGAGAAAAAAAGTCAATGTGTAGTGATTAGTGGCGAAAGTGGATCGGCTTCGTCAGTGGAGAAGACTATTCTGGGAGTTGGACCGGTTCTTGAGGCTTTTGGAAATGCTAGCACTGCATACAACAACAACTCAAGTAGGTTTGGGAAATTTACACAAATCAAGTTCAGGCAGGATGGTGCAGTATGCGGAGCTGCATTAAGGAAATATTTGTTGGAAAAGTCTAGAATTGTTTCACAGGCTCCAGAAGAGAGGAATTATCACGTGTTTTACTATTTACTTGCTGGAGCGAGTCCAGAGGACAAAGAGGAACTCCACCTCACAAAACCAGAGGAATATTGTTACCTTAATCAGAATGAATGTTACTCCCTTGAAGGGATTGATGAAGTTTATGAATTTCTAAGACTCAAGAAGTCTATGGAGATGGTAGGCTTTACTGCTGATGTACAAAAGAGAATTTTTAGCATTTTATCTGCTGTTCTTCGCATTGGAAACTTGAAGTTTTCACGGAGACCAGGACATGAAGAAGCAACCATCAAAGACAGTGAAGACGTGACTATAAATATTGTGTGTAGTCTTCTCATGGTAACTCGCCGCAATCTTATTGAAGTTTTGACAACCAAGAAAACTAAAACCAGAAATGAGCAGTTTATCGTACCCTACAAATATGAAGAGGCTATAGCCACAAGAGATGCAATGGCCAAAGCCTTGTACGGCACCCTGTTTGACTGGATTGTGTTACAAGTGAACCATGCGCTGGCTATGAAGCAGTCAACTGTGGTAGAGGGATGCTCTATAGGCGTTCTGGATATTTTTGGATTTGAGGATTACCAGCATAACAGTTTTGAACAATTCTGCATCAACTTTGCCAATGAGAAGCTTCAGTTCTACTTTAACAAACACGTCTTCAAACTGGAGCAGGATGAATACATTTCTGAAGGGATTGAGTGGAGGAATGTGGACTTTGTTGACAATGCAGCGTGCTTGGAGTTGATATCTGGTCGACCAACAGGCCTGTTAAACCTGATTGATGAGGAGAGTAGTTTTCCTGGTGCCACAGAAAGTTCTTTGTTGACCAAACTTGACAAGAACCATTCAGGTGACAAGCATTATGAGCAGTCTCTCATACAACAGGCGTTTGTCATCAAGCATTATGCAGGAAGTGTCAAGTATAAGATCCAGGGATTTTTGGACAAAAACAGAGATCTCATGAGACCGGACATTTTAAGTGTTCTGAAGAACAGCGATTCAAGATTTGTGAGAGACTTGCTTGGAGCTGACCCAGTAGCCGTGTACAGGTGGTCAATTCTCAGGTCTTTCTTCAAAGCTGTACATGCTTTTAAGATGGCTGGCAAACAGCATCGTTCAAGTGGTAAAGCAAACGATCGTCTAGCCAGTCTAGCAAGTCCAACAACTCGAAAGAGGAAAAGTATGACAAGGGGTTCAAGGCTGAGCTTGCATGATTCTGATGAAGGAGCTGCGATTGCAAACAGCGAAACAGCAAATCTCTTCAGAAAAGCCTCCAGGGTTATCAGGAGAATGCAAACTAACAAACAGTCAGTTAAGCCATTATCCAGGATTCTTCAAGGTCTGGAAACCAAACGGGACATGACTGTACGGTCGTTTGATTACCTGTACAGGACAATGCAGAGAGGCAAAGGCACACCCAAGAACCCGCCTACAGTCAGCGCTCAGTTCCAGTCTTCTCTTAGTCGTCTCGTGGAACTCCTGGAGGAGGCTCAGCCATTCTTCGTTCGCTGCATCAGATCTAACGCGGAGAAGGCGCCCATGACATTTGATCGCGAGTTGGTGGTTCGCCAGTTGAGATATACAGGCATGCTAGAGACTGTACGAATCAGGACACTAGGTTATCAGTGGAGATTCACGTTTGAGGAATTTGTAAAGCGATACAGCTTGCTGTTCCCGCGAAAAGAGATGAAAGCTGTGCGCGAAGAGATGCCGGTCATTCTGGAGTCCTTGAGACTAGATCCTTGTGAGTACCAGATGGGCAAAGAAAAAGTGTTTCTGCGAGATAGTCAACACTCCTTGTTACAATCGCGGTTACATTCAGAGCAGATCCACAAGATCTGTGTTCTACAACGCTGGATCAAAGGAACGCTACAGAGGAGGCAATTTATCAGACAAAGAAATGCTGTCGTACTCATTCAGGCATGCTGGCGCGGTTACCTAGCTCGTGCTGAACTCGAGGAACAGACTCTCGCCGCCCTTCGGATCCAGTCTCAATGGAGAATGTACTTGGCGCACCGTCATTATCAGAGTATACGTGACAGAGTAATTTTGCTTCAGAGTCACGCAAGGGAAAACTGGCGAGAAAAAGACATTTAG

Transcript

OS493_013819-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q63358	Unconventional myosin-IXb OS=Rattus norvegicus OX=10116 GN=Myo9b PE=1 SV=1
Q13459	Unconventional myosin-IXb OS=Homo sapiens OX=9606 GN=MYO9B PE=1 SV=3
Q9QY06	Unconventional myosin-IXb OS=Mus musculus OX=10090 GN=Myo9b PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002346 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00612 all species →	IQ	IQ calmodulin-binding motif	Motif	Interproscan
PF00063 all species →	Myosin_head	Myosin head (motor domain)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036961 all species →	Homologous_superfamily	Kinesin motor domain superfamily	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR000048 all species →	Binding_site	IQ motif, EF-hand binding site	Interproscan
IPR001609 all species →	Domain	Myosin head, motor domain	Interproscan
IPR046987 all species →	Family	Unconventional class IX myosin	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46184 all species →	UNCONVENTIONAL MYOSIN-IXB-LIKE PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0003774 all species →	Molecular Function	cytoskeletal motor activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016459 all species →	Cellular Component	myosin complex	Interproscan
GO:0000146 all species →	Molecular Function	microfilament motor activity	Interproscan
GO:0005096 all species →	Molecular Function	GTPase activator activity	Interproscan
GO:0005884 all species →	Cellular Component	actin filament	Interproscan
GO:0035556 all species →	Biological Process	intracellular signal transduction	Interproscan
GO:0051015 all species →	Molecular Function	actin filament binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_013819-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_013819-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

74.6Max TPM

20.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.82	21.48
polyp at pH7 6	18	18	14.11	20.92
coral polyp · control treatment	16	16	26.41	44.44
coral polyp · oil and dispersant treatment	16	16	32.15	46.31
coral polyp · oil treatment	16	16	19.88	32.47
coral polyp · dispersant treatment	16	16	28.52	74.63
Polyp	10	10	6.73	11.10

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.48
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.27
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.05
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.02
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.53
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.36
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.81
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.80
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.20
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.45
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.15
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.04
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.88
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.41
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.14
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.10
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.28
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.82
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.92
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.31
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.27
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.78
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.27
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.82
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.17
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.09
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.62
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.29
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.18
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.78
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.61
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.05
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.00
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.45
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.67
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.76
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.44
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.86
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.02
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.31
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.98
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.23
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.05
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.52
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.93
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.29
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.15
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.68
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.17
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.76
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.74
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.53
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.31
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.82
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.56
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.51
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.66
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.41
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.94
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.91
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.44
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.98
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.70
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.04
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.69
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.38
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.54
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.51
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.47
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.21
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.21
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.53
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.00
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.41
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.32
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.88
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.55
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.54
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.97
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.13
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.80
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.77
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.59
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.64
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.63
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.79
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.67
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.25
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.83
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.64
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.13
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.30
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.14
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.94
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.67
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.02
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.10
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.61
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.63
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.95
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	11.10
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	9.58
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.91
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.27
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.03
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.76
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.18
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.83

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.