Gene detail

Detailed information of OS493_014255-T1 in Lophelia pertusa

Genomic Location: scaffold_40:1258899...1282016
NR annotation: KAJ7373107.1, Ankyrin repeat and IBR domain-containing protein 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_014255-T1

ATGGGAAGTTCAACATCAAAGTTCCGCAAAGCCCTCCAACGAGGAGAAGGTGTAGAAGCCATGCACATATATCTCAAGAACCCTGACATCAAAAGAAATCTTGATCCAAACTACAGCTTTGGAGTGAACCATGGCCACAATACGGCTCTCCATTACGCCTCGATGCATGCCATGAAAGCATTTATACGTGAGTTCCTTGAGGAAAGAGCGAACCCTAATATTCGAAACGGTGCTGGACAGAACGCACTTCACTGTATTTGTTCCTCATATCGGGGCGCCGAGGCATCGGTTGATAAAACCAGGGCCGAGTGCTTATCGAATCTTTTGGGCTGGAATTCAATCCTGCAGGAGGGAATAGCGCTTGAGATAGATTCACCGGACGAGGCTGGAAACACCCCCCTGCACTACGCTGCTGGCTCTGGACTACATCAATGTGTTCAACTGTTGGTCGCCAATGGAGCTTCACTGTATGAAGAAAACAAAAATGGTGCGACTGCCTGCGATTGTGCAATAAAAAGAGGATTTAGCTCTATTGCTTCTTTCCTGGAGTCAAGGATGGTTTTCTCTGAAACTCCAAGTGCCAATGCAATTGAGGAGCCAGTTTTCATTAACAAAGATGATCAGAAGCAATACCGGGGTCTGTGTGCTCAGGATCTTCAAGAAGCAAAGGACTTGATGCTTGTAGAGACTGCGGATATGCTCAGGGTCCCATTATTTACTGCTGAAGGACTGCTTAGAAATCATGAGTGGTCAAAAGAGGCTCTGATTGATGCGTGGATGTCTGGTCCTGTTGCAGCTTGTGAGAAGGCTGGAGTCACTCTTCCAGAGAATCATGTGCCGAGCAATACTGTAACAGAACTTGAAGAGAAAACCCAACTTACAATGAAAAGCAGCTTTAGAACATCTGAAGTCTGCTCCATCTGTGAGGATAAAATAGTCTATGAAGATGTTCCGCTGTCTCTTTCTTGTGATCATGAATTCTGCCGTTCCTGCTGGGAGTGTTATTTGAATGTGAAGATCAGAGAGGGGAAAGCGCACAGCATACAGTGTCCTGCATTTGATTGCAGTGCTCTTGTACCTGTGGAAACTATTGAAAGTCTTGTATCAAGAGAAATGGCAAGAAGATACCTTCAGTTTGATATAAAGGACTTTGTAGAAAGTAACCCCACACTGAAATGGTGTCCTTCCCCTGGGTGTGGCCGAGCAGTGAGGCTGCCATCAAACCTGCTACCCTCACTGCATGTCACTGTTGAAGCAAGTTCATCTGAGGAAACAGAACCTATGATTGTGGACTGTGGCCATGGTCACTTCTTCTGCTGGCATTGTTTGAATGAAGCCCATGCACCTTGTGCCTGTGAACTCTGGAGTAACTGGCTCAAGAAAATTGCAGAAATGGTGCCGAAGATACCTACAATGCAAGCTATTTCTGAGTGTCCTGAAACAGAAACAGTCGCCAACACACTATGGCTGGTGACAAACTCTAAATCCTGCCCCAACTGCAAATCACCCATTCAGAAGAATGAAGGATGTAACCATATGAAATGTACAAAGTGTAAACACGAGTTCTGCTGGGTTTGTCTGGAACAATGGAAAAAACACAGCTCGGCCACAGGAGGATATTTTAGGTGTAATAGATTTGAAATTGTACAAAAAGTGGAGTCAGAGTCAGCCAAAGTAGTAACTGAGGCAAGTGTAAAGAATGATCACATCACAGAGTTAAACTGTTTTCTACATTACTACTCCCGCTTCAAGAATCACGAGAATAGCTATAAGTTTGAAGAACCTTTATTAAGTACAGCTAAAGATAAAATGACGGCACTGGCCGTTGCTACCATGGAAACAGCAGCTACAGCTGAAAATGTCGACACATCATTCATTGAGGACGCTGTGCATGAATTGCTCAATGCTAGAAGAGTTCTCAGAGCTTCATATGCTTATGGTTTTTACCTCACTGGAAACAAGGACAAGAAAGTTATCTTTGAATCGCTGCAGACTGAAATAGAGGAAGCAACAGAGACCCTGTCGCAGATGGTAGCTCGGCCGTACTTAAGAACACCACGTGCACAGATCATCCAAGCCACGCAGCTAGTACATAGAAAACGACAAGACTTCTTGTTGGCTTTATCGCGGGGACTTATCCCTGATGATAACGAGGTTCCTGAACCCAGGAGATTTGTGTCCAGGTTTCATCTACTCTCACCATCTGGTGTTAGTCAGGATAGTGAGTCTGACGAGGACGAGGATAACTACGATGAAGTTCGCTGTCGGATTGAACAATCAATTATCAAAGAGCGTCTTTCTCGCTTGGCGTCATATGGAGCCTCCGACTCACCCCCGCTGAGTGGTGGTGATGTTGAAGAACAAGCGACTGCCAAGGAGATAACCAACTGCGAGGCCATTCACAAAAGATTTAACCTCACCTCCTGCTACTTATGCAAAAATGGGAATGCAAAAGACAAGAGAGAGGAAAGAAAGAAAAGAAGCCACCGCCAAAGTCAGCCAGTTGAGATTGATGAGGAAATTGATGCCGATTTCATGAGAGCAATCCAGCTGTCATTGCTACAACACAGTACACCAGCCAAACAGAGAAGCCGTCAATCAAGCTCATCCAGCAGCTCAGCAAGCTCTAACAGAGATCAAGCACAAGGGGTGCAGGCACCGCAAGATATGTCAATCTTCTCTGTTGTTGATGGCGCTTCTCTTCAAAAAGCTATAGAGTTGTCACTACAAGACTCTGCTGTAGGATCCGGAGAACTGTCTTCTTCAACAGACGATGATCTTACAAGAGCCATCAAGCTATCACTGCGGGACGGTGATACTCCCCCAGTGGGCAATGATGGCAGTGAACATATGGACAGTAATGATGGCACTGGACACATGGACAGTAATATTGTCAGTGGACACACAGACAGTAATGTTGACACTGGACACATGGACGGTAAAATTGTCAGTGGACACACAGACAGTAATATTGCCAGTGGACACATGGACAGTAATGATGCCAGTGGACACACAGACAGTAATATTGCCAGTGGACACATGGACAATACTGATGGCAGTGGACACACGGACAGTAATATTGGCACTGGACACACGGACAGTAATATTGCCAGTCGACACACGGACAGTAATATTGCCAGTAGACACATGGACAATACTGATGGCAGTGGACTCATGGACAGTAATATTGGCACTGGGCACACGGACAGTAATATTGGCACTGGACACACGGACAGTAATATTGCCAGTAGACACATGGACAATACTGATAGCAGTGGACACATGGACAGTCCATCACAAAGCCATCAATCAAAACCTCAACAAAGCAGTGACAGCGATAGTGAATACGACAGTTTAGAAATCTATTTAGCTAAATTAAATTGA

Transcript

OS493_014255-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9P2G1	Ankyrin repeat and IBR domain-containing protein 1 OS=Homo sapiens OX=9606 GN=ANKIB1 PE=1 SV=3
Q6ZPS6	Ankyrin repeat and IBR domain-containing protein 1 OS=Mus musculus OX=10090 GN=Ankib1 PE=1 SV=2
Q1L8G6	Ankyrin repeat and IBR domain-containing protein 1 OS=Danio rerio OX=7955 GN=ankib1 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005499 (this species only) · gene tree & orthology
Ubiquitin family	E3\|E3 activity RING\|RING · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 activity\|RBR · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00023 all species →	Ank	Ankyrin repeat	Repeat	Interproscan
PF13637 all species →	Ank_4	Ankyrin repeats (many copies)	Repeat	Interproscan
PF01485 all species →	IBR	IBR domain, a half RING-finger domain	Domain	Interproscan
PF19422 all species →	Ariadne	Ariadne domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan
IPR047564 all species →	Domain	Ankyrin repeat and IBR domain-containing protein 1, Rcat domain	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR002867 all species →	Domain	IBR domain	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR003903 all species →	Conserved_site	Ubiquitin interacting motif	Interproscan
IPR017907 all species →	Conserved_site	Zinc finger, RING-type, conserved site	Interproscan
IPR045840 all species →	Domain	Ariadne domain	Interproscan
IPR044066 all species →	Domain	TRIAD supradomain	Interproscan
IPR031127 all species →	Family	E3 ubiquitin ligase RBR family	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11685 all species →	RBR FAMILY RING FINGER AND IBR DOMAIN-CONTAINING	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0000151 all species →	Cellular Component	ubiquitin ligase complex	Interproscan
GO:0000209 all species →	Biological Process	protein polyubiquitination	Interproscan
GO:0004842 all species →	Molecular Function	ubiquitin-protein transferase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006511 all species →	Biological Process	ubiquitin-dependent protein catabolic process	Interproscan
GO:0016567 all species →	Biological Process	protein ubiquitination	Interproscan
GO:0031624 all species →	Molecular Function	ubiquitin conjugating enzyme binding	Interproscan
GO:0032436 all species →	Biological Process	positive regulation of proteasomal ubiquitin-dependent protein catabolic process	Interproscan
GO:0061630 all species →	Molecular Function	ubiquitin protein ligase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11967	ANKIB1; ankyrin repeat and IBR domain-containing protein 1	EC:2.3.2.31	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_014255-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

90.3Max TPM

38.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	33.31	53.55
polyp at pH7 6	18	18	34.44	56.86
coral polyp · control treatment	16	16	46.49	90.31
coral polyp · oil and dispersant treatment	16	16	45.83	71.70
coral polyp · oil treatment	16	16	44.90	66.37
coral polyp · dispersant treatment	16	16	30.99	51.40
Polyp	10	10	29.25	53.30

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	53.55
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.29
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.07
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.97
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.53
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.27
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.01
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.91
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.42
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.29
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.14
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.10
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.85
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.46
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.19
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.66
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.88
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.86
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.70
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.89
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.56
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.49
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.63
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.29
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.03
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.93
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.81
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.98
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.91
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.69
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.53
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.32
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.17
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.51
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.70
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	90.31
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	76.79
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.64
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.55
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.12
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.41
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.47
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.39
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.17
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.16
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.41
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.85
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.29
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.57
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.66
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.01
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	71.70
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.69
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.57
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.13
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.64
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.59
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.89
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.12
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.46
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.42
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.31
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.87
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.19
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.07
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.57
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.00
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.37
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.50
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.07
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.08
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.73
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.18
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.31
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.14
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.12
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.05
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.64
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.93
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.43
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.92
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.42
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.57
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.40
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.88
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.80
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.99
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.71
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.60
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.13
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.50
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.36
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.04
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.80
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.37
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.83
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.98
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.58
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.94
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	53.30
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	46.50
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	33.62
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	33.24
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	33.22
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	30.05
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	19.37
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	17.60
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	13.06
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	12.55

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.