Gene detail

Detailed information of OS493_014279-T1 in Lophelia pertusa

Genomic Location: scaffold_40:1642743...1661253
NR annotation: KAJ7373131.1, hypothetical protein OS493_014279 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_014279-T1

ATGATAATGCTAAGGCAAGAGTATAAAGAGAGTGACTTCAAGCAGTACTGGATGCCAGATGAGAACTGCAAGGAGTGCTATGAATGTGGTGAAAAGTTCAACACTTTTCGTCGTCGACACCACTGTCGTCTCTGTGGCCAGATATTCTGCTACAGGTGCTGTTACCTGGAAATACCTGGACAGATCATGGGATATACAGGGTTTTTGCGAGTTTGCACCTACTGTCATAAAGTAGTGCAGCGGTATACCCAATCAGCTGACTTGAACGTGGTCAGAAATCTGGAGCAGTTGCAGGCCGACTTGCGTGCAGTCAACTCTGACGCAGATATCAACACCAACAGTAGCAGCAACATAAACTCGACACTTCCTAAACCCTATCCCTTTGATTTTGATGACGATGAGAATTTCACATATGTTCATCCATCACTCAGAAAGATTAGTAGCACCGGCACCACCATGACGGCGATGAGTTCTTATTATGAAAAGTTTGACCAGAAAGAAAGACTATCACCCATGCCAGGGCGGAGACCATTTGATGCATTTGGAGTATGTGCGGCAGAAGCTGACATGTTGAAACAGGACTCTTTCCGTGAGTTGTGGAATCAAATCATGTCGCCAAGGTCTGGATTAGAACTTCAGAGTCACCGCTTCCGCTTGAGGACTTATCATAATTGTTTTGTTGGAAGTGATTTAGTTGACTGGCTCCTCACTTACGAGAAAACATCTACAAGGAATCAGGCTGTCATGTTAGGACAATGTTTGCTGGAGTCTGGCTGGCTGGAGCCTGTACCCAACACACGTGATGGGGGAGCAGTCTTCAAAGATGAATATGTTCTGTACCAGCCTGGAGTGTCTGCAGCACGAGAGGTATTAGCCAAGAGGTCATCATTATTCTGGACCGAGACAGACAAAATTGAGTCACTGAGTGAGAGTGATGAGATTATCAACGATAATGCTGACGATGATAACGATGAAACAGTACCTCACTGGTTCCGACAGTTGGAGCAGCATGGAGTTGAATCTGGTACTGAGGAGCTTGATGCCAGTATGAGTCATGAGGTATCTGGGAAATTGAATAATCTAAAAACAACAGGACCAAAGCTTCTGGACCTGGATTTGATGAATGGCGTCACATCCGAGGAGGGAGACAGTGAACTGTCACTCAAAGTGGATTTGCAACATTTTGGAGAGCCTGGAAGACTCGGCATGGCATCACCAGACACCCACAGTGAAACAGCAGGCTCCAAACTGTCTCTGATAACAGATGCCCCTCCACCCCCGCTGGAGCAGTATGTGTACAACGAAGGGTACCCGTACACCCCTCTGAGACCAAGCAACAAGAAGAATCAAGAGGAACCGATGCTTAGCACGAGCAACACCCCAGATGAGATATTTAGTGGTGCCATGATCGCAAGGAAGATTGGTGTAGACAGACCTCCTGCGCCTGAAGTTGGTGAACTGAGGGAGGATAATGGAGAGAGACTAGCTATGGAGCGACTGAGGACTGCACACACACACCATCTAAACACTCTGCTGGAGCAACTATTGAAGGATGCTGGGCTGTCAGTTGTTTGGAAAGAGACTATGTTGCCTTTAGTGAAGAGAGTTAGTGAGCAGGTGACCCCTGATGTTCGTAGAGATGATGATATGGATATTTGCGAGTATGTGAAGTTCAAGAAAATTCCAGGAGGAAACAAGAGTGACTGTGAAATGATCAGTGGTGTTGTGTTCACCAAGAACATTGCTAACAAGAAGATGGCCTGTGTGTTGACCAACCCTAAAATTCTAGTTCTAAGCTGTGCCATTGATTATCAGCGTAACGAAAACCGCTTGGCCTCCCTTGATCCACTTGTTCTCCAAGAATTTGAGTTTCTGAAGAACTTTGTAGCAAGAGTGGTTAGTTTACGACCCAACATTTTGTTGGTGGAGAAAACTGTTTCACGTCTGGCCCAGGACATGCTTCTGAAACATGGAATCACTCTGGTCTTGAATGTTAAACCAGAAGTGATTGAGCGCATAGCCAGGTGTACACGAGCGGATGTTCTCTGTTCCATGGAACAACTTAGTCGACCACAACTGGGATCCTGTCAATCATTCAGGGTTCAGAGATACACTCTTAAGAATGGAGAGTCCAAGACACTCATGTTCATTGAAGGCTGCCCGCTGATCTTGGCTGCACTGTGA

Transcript

OS493_014279-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Y2I7	1-phosphatidylinositol 3-phosphate 5-kinase OS=Homo sapiens OX=9606 GN=PIKFYVE PE=1 SV=3
Q9Z1T6	1-phosphatidylinositol 3-phosphate 5-kinase OS=Mus musculus OX=10090 GN=Pikfyve PE=1 SV=3
O96838	Putative 1-phosphatidylinositol 3-phosphate 5-kinase OS=Drosophila melanogaster OX=7227 GN=fab1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002213 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00118 all species →	Cpn60_TCP1	TCP-1/cpn60 chaperonin family	Family	Interproscan
PF01363 all species →	FYVE	FYVE zinc finger	Domain	Interproscan
PF00610 all species →	DEP	Domain found in Dishevelled, Egl-10, and Pleckstrin (DEP)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002423 all species →	Family	Chaperonin Cpn60/GroEL/TCP-1 family	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR000591 all species →	Domain	DEP domain	Interproscan
IPR000306 all species →	Domain	FYVE zinc finger	Interproscan
IPR043548 all species →	Family	1-phosphatidylinositol-3phosphate-5-kinase	Interproscan
IPR027409 all species →	Homologous_superfamily	GroEL-like apical domain superfamily	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR017455 all species →	Domain	Zinc finger, FYVE-related	Interproscan
IPR011011 all species →	Homologous_superfamily	Zinc finger, FYVE/PHD-type	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46715 all species →	1-PHOSPHATIDYLINOSITOL 3-PHOSPHATE 5-KINASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0035556 all species →	Biological Process	intracellular signal transduction	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0000285 all species →	Molecular Function	1-phosphatidylinositol-3-phosphate 5-kinase activity	Interproscan
GO:0012506 all species →	Cellular Component	vesicle membrane	Interproscan
GO:0030593 all species →	Biological Process	neutrophil chemotaxis	Interproscan
GO:0031410 all species →	Cellular Component	cytoplasmic vesicle	Interproscan
GO:0032438 all species →	Biological Process	melanosome organization	Interproscan
GO:0052810 all species →	Molecular Function	1-phosphatidylinositol-5-kinase activity	Interproscan
GO:0090385 all species →	Biological Process	phagosome-lysosome fusion	Interproscan
GO:1903426 all species →	Biological Process	regulation of reactive oxygen species biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_014279-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_014279-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

104TPM > 0

7Conditions

14.0Max TPM

4.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.25	12.84
polyp at pH7 6	18	16	4.58	10.48
coral polyp · control treatment	16	16	5.98	13.39
coral polyp · oil and dispersant treatment	16	16	4.58	13.28
coral polyp · oil treatment	16	16	4.43	10.53
coral polyp · dispersant treatment	16	15	5.63	13.97
Polyp	10	7	0.57	2.07

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.84
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.37
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.73
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.62
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.60
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.36
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.34
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.09
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.78
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.47
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.29
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.07
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.79
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.46
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.20
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.20
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.82
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.51
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.48
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.21
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.12
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.87
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.51
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.87
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.36
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.59
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.57
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.55
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.10
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.08
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.05
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.71
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.84
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.49
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.39
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.94
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.75
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.26
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.17
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.82
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.55
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.36
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.93
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.16
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.98
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.38
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.09
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.00
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.10
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.81
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.28
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.36
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.89
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.11
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.08
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.12
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.06
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.82
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.72
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.07
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.60
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.30
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.13
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.61
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.07
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.53
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.72
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.94
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.36
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.21
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.19
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.05
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.67
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.43
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.39
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.34
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.15
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.12
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.43
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.71
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.63
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.97
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.90
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.28
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.36
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.24
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.08
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.76
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.44
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.86
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.84
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.83
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.33
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.76
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.68
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.80
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.07
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.10
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.88
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.77
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.50
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.39
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.03
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.