Gene detail

Detailed information of OS493_014377-T1 in Lophelia pertusa

Genomic Location: scaffold_41:194190...240583
NR annotation: KAJ7361737.1, regulating synaptic membrane exocytosis [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_014377-T1

ATGCGAAAAATGGCTGGTTTTAGATGCCCTGCTTCTCCTCCGCCTCCAGATCTCTCCAATTTAACCGAGGAGGAGAAGGAGATTATACAGAACGTGTTACAACGTCAGAAACAAATGGAGGACGAAACGGTCCAGCTGCAAATATCGTTACAGAAAGAGGTTGAAAGCTATCAACATAAAGCTGAAAAAAAGACTGGTCAAACAGAGACTGTTTCTAAGGAAGACAGTGTCTGCGACATTTGCCACAAGACAAAATTCACCGATGGAACAGGAAGAGAATGCAAGTATTGTAAACTCAAAGTCTGTGCACGGTGCGGTGTGCAAGTCACCATACCCGGAACGAAACAGGTTTCATGGGTGTGTCTTGTGTGCCACAAGAAGCAGGAAATGCTCACTAAGACTGGTAACTGGTTTGGCTCATTAACTGGGGGTGACAAAAAGCCAAATGATGACTCGGACTTAAAATTAGGAAGTGACTTTAGGGCAATCCCAACGGAAGAAGACAAACGAGCTATGAGGCGACAAGGTTCATTTCAAAGATCTGATTCTGGCAGGGGGAGCTCAAGGAGGGCAAAGGGGAGGCCTGATAAAGACACTGAACGGAATCGCTTTCGTAGGCCATCAGTATCTGACGAGGAGGTTGATTCACTTCATGAGACTCCTCCTGGAAGCCCGGCATACTTGAGTGACGATGAGTTGTACAGACCAGATGAAAATAAAGTGAGACGGAAAGTTGTCAAATTCAAGGGACACGAAGAGCTAGACCATGCGCCTAAAGGTCGTCTTCCTGGTACCGTGTCAAACATGCAGAGGTCTGGTCCTGTCAATCAAGGACCAGGAAGAGGAGCAACAATGCCTGGTCAGGCACCAGGAGTAAGACCAGGACAATCACAACCCCAGGGGTCAGGGGTTAGACCAGGTGGTGCACCTGGGGCACCTCAGGGAAGGGGAATGCAAGGTCCAGGATCACAGCCTGGAATGCACCCCAACTCTTCTCCTCAGCAGCAAAATTCAAGCTTTACTCCTGTGGGTCATCCTGGAACCTCTCCCTCCAGCCGTGGACAATTCCCAGCACCCCAGCAACAAGGTCCCAGAGGAGCTGGTGCACCCAATCAACCCAGACCTGGTTATGGAATGAGGGGTCCTCCAGGGCAGCAGCAGCAACAGCCAAGATTTCAGGCACCTCCACAACAAAATGCTGTTGGATATGGCAGAGGAACACCTCCTGGTAGTCGACCTGGTGCCCCTCCTCCTGGGCAGATGGATGGAAAACCTGGTTATGGTAGAGGGGGACCCCCTGTCTCCCAACCCGGCAACCAGATGGGACCTAGACCAGGAGGACCTGCAACTGCACCTTCATCAATGGACAACAGGCCAAGACAACCAGGTAGTTTCCCTCCAAATCATGTTGGTGCTCCTCAACTTGGGCAAGCTGGTCCTAGACCCGGTGACCGTATCGGACCTCAGCAAAGTCCAAGAGCGGGTGCACCACCAGGAATGGTGCAGATGGGGCCCAGGTTTGGTGCTGCGGGACAGCCACGACATGGCATGCCAGTGGGCCAGCAAGGAGGCCAGCACCAGCATCCAGGCCAGTTGGGCTCACCAAGGCAAAACCAAGCTCCAGATCAGCTACATGGACAGTTAGGGTCTCCTAGACAAGGACCTCCTGGAGACCAACAACCTAGAGGGCAGATTGGTTCCCCCCGTGTAGGTCCTCCAGCTGACCAAATAAGGGGTGCAATGAGCTCCCCTAGGTTAGGTAGTCCAAGGACCCCCTTAGGAGCACCACAGCAAGGCCCGTTTCCAGATCAAGGAAGAGGACAGTTAGATGCTTCGGTGGACCCAACAAGAGGGCGATCAGGTCCAGCTCCACAAGAGCCAAGAGTAGACCAACCTAGGGCACCATACGGCACACAACATCAGAGCTCTCCTTTGGACCAACCAAGAGGACAGTTTGGGCCTTCACAGCAAGCACCTACAATGGACCATGGAAGGCCTAGAGTTGGTTCTGCTGGTAAAGGTGCACCGGTCGATCAGTCAGGAAGGCAGCAGGTGCCAGACACTAGAAATGGATATAGTCCTGATGCTTTAAGCACAGGTGTTCACAAGTTTCCAGAACATAATGCTCCTGGCACACAACAGCGGGCTGACAGCAGAAATGGACAAACGGCTGATGGTTCAATGATGAATGGAAGGATGGGCCCTTCATTTCCCAACAGACAGGACAGACCTGAACAGCGAGGTACTGGTGACGTTGATCAACGTGGCATGCTGGGGCAGTCATCAAGACCGGTAGACAGACCAGGGTACCAAGGAAGTCAACCCAGACCTTATAATGACGATGTTGATGGCAGAAGAAGCCCTCCAAGAAGGATCTCACTTGATGAACCTAAAGACAAGACCTTTGTTAAGTGGTCTTCACCTGATGAGGATAACAAATGTTTAGGAGAAGTGCTTCTCATGGTAGATGCCAAAAGCAGGGGTTCATCCACTGATCCTTATGCAGCGTATGGTCTGAAGGTGATAGGTGGAAAGATGACAGATGATGGTAAACTAGGAGCTTTTATCACTGAAATTAGAAAAGGAGGGCCTGCGGATAGACAAGCACAGCTTCAAATAGGTGACGAAATTCAGGATTGGAATGAACAGTCACTTGTGGACTGTACATTTGAAGAAGTAGTGGAGAGTATTAATTCATCAATGGAAGACAATCAAGACAGTAATGAACTTCATCTTATCGTCTGCAGAGATAAGAGTAAATTTCCAGGAAGGACCACCCAGTCACCCGTCAAATCACCGCGTGGACAGGAAGTGAAGAGAGAGTCTCCTAAACAGGTCCCCACAAGAGAGTCCCCTGTCAAGAGGGACCGCGTATCACCCTCCGCAGCTCCCATGTCACTTCAACAGGACAGAAGACCACAGGAACGAAGGGAGGAGGTCACAACGACACCAACGCAGAGAGACACTATCACAACAACACCAATACAGAGGGAAAATGGTCCTATGATGAGTGGAAGAACTCAGCCTTCATCATATGAGCCAAACAGGTGTGGTGTTATAACAATCTATGATGACTTTTTCTTTGGCGGTGGTCCTATACCTGATGAAAAACCTACAAAGTCTTCTGTAAAGCAAGTAAATACAGGACCTGTGCAAGGCAAGGCATCAAGGGTTACTGGCCGACTGCAGTTGAAGCTGTTTTATGACGAAGATGCTGCAAATTTAAACGTGACTGTTGTTGGAGCTGAAGGCTTAGCACCAAAAGAGACAACGACCCCGCCCAACCCTTACGTCAGGATTTACTTTCTCCCAGATAAGAGAGCAAGAGGCGAACAAAAAACGGCCATGAAGTCCACAAATCCTAAATGGAATCAGACTTTTGTGTATCCATGCAGGCCACAGAAGTTCAGTGGCCGTGCTCTGGAAGTCACCGTGTGGGATTACGACAAAGTAGGATCGAGTGAGTTTATTGGCGAGGTTGTGTTGAACATGACCGAGGCGAACCTTGACAGTAATGGGTACTGGTACCCACTCAAGAACCACGATGACGACAATGATCCTCTCGTGCCACCCACTCCGAACCAGTCCCCTCATAATTCATTCAGATATAAGGGACCGAGAGGACCTGGTGAACCAGCAACCGAGCAAGCCGGTCCAACTGGTTATGGCAGTGATTACGAAGAAGAGGCGCGGTTTACTCCGAATGGACCGGTAACTAGTTCTCAGCCTCCCTACAACTCGGCCGAGAATGAGCTCTTGAAGCAGCAGTTGATTGATCATCACCGCGACAGTCCCAGGCCTCCTTTTACGCAGCCGCAGATGGTGCAAGCGTACACTGTCAAGCAATACAACACGTCACCTACTCATCAGCCCCAGTCTCCACCGGCTCATCCAGCCGCTAGCTACCACCCCCACCATTACGCCGCTGACCCCAACAGAACGCCGCCGCAACAGACTAGACCAATGCCTTCTCACCAGTCTCCTCACCAACATGGTCCAACTGGTCCGCGCTTTCACGACGGTCGCATGTCCCCGAGTATGCATGGTTATACTTCCCCAGGATCGTATTCCCCTGGTAGAATGTCCCCTAGCGGAGGCCCCGGGGCTAAAAAGTCCCGCTTGTTGCCTCAACTGCCTCCAGGACGTGAACCGATGGACGAGGAAGAACGCGCTCGAGCCGTTAAACAGAAAATAAAAGACGTCGACCCAGTGAGAGCTAAATTGGTAGTCGGCGGCGCCAAAGGGAGGATGGGATATGGTCAGGCCCCAGACGCCGTGTTTACGCAAAACGAACCGGGCATGTATGACCCAAGCATGTCCCCGAGACCTGGGCGCCAGTCTCCGAGGCCCATGCCAAGAACGGGGAGTCCGTCATCCTTAGCAGGGCCAAAACATTCCCTGGGGATGCCCCCACAGGCACATCATCAGCAGGGGTTACATACTCCTCAAGAGCGCATGTATTCACCCGATATCACCACACATGAGCAAGGAGCGCCATATGAAAGCCACAGAAAACCTCAGGATGGACGTACACGACGCCGTAACAGTTTAAGCAGTTTACCGCTGAACGATTCAGAAGCCGAGCGGCCGCGAAGTCCTTTCCCAATACCTAGTCCAGTCCCTCTCGGTCATGGCAGGAGTCAGAGTAGCTCCAGTTTACACGAAAGGGACCGTGGGCTTCCTAACGGCAAGCTGCTGGTTCGTGAAGATGCTCGTGCCGGCAGTCTTAACAATCTTCATGTCTTCCCTACAGGGGGGTACATCAAGCCTTCCCGTGGGACTGGGCGTAGTGAGAGTTTTGGAGGCAGTGGACGGAGCAGTCGATCATCATCTATAGCAAGTGACAGGAGTGGCAGCTTGAACAGTATACCAGGCTCGGTTACAAGTGTCGAGAGTAGCAAAATGAAGACAAGTGATTATGTGGAGAATAAGTTGACAGAGTGA

Transcript

OS493_014377-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9UQ26	Regulating synaptic membrane exocytosis protein 2 OS=Homo sapiens OX=9606 GN=RIMS2 PE=1 SV=2
Q9EQZ7	Regulating synaptic membrane exocytosis protein 2 OS=Mus musculus OX=10090 GN=Rims2 PE=1 SV=1
Q9JIS1	Regulating synaptic membrane exocytosis protein 2 OS=Rattus norvegicus OX=10116 GN=Rims2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001484 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00595 all species →	PDZ	PDZ domain	Domain	Interproscan
PF00168 all species →	C2	C2 domain	Domain	Interproscan
PF02318 all species →	FYVE_2	FYVE-type zinc finger	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011011 all species →	Homologous_superfamily	Zinc finger, FYVE/PHD-type	Interproscan
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR036034 all species →	Homologous_superfamily	PDZ superfamily	Interproscan
IPR017455 all species →	Domain	Zinc finger, FYVE-related	Interproscan
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR010911 all species →	Domain	Rab-binding domain	Interproscan
IPR001478 all species →	Domain	PDZ domain	Interproscan
IPR039032 all species →	Family	Rim-like	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR041282 all species →	Domain	FYVE-type zinc finger	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12157 all species →	REGULATING SYNAPTIC MEMBRANE EXOCYTOSIS PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0006886 all species →	Biological Process	intracellular protein transport	Interproscan
GO:0031267 all species →	Molecular Function	small GTPase binding	Interproscan
GO:0006887 all species →	Biological Process	exocytosis	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0042391 all species →	Biological Process	regulation of membrane potential	Interproscan
GO:0042734 all species →	Cellular Component	presynaptic membrane	Interproscan
GO:0044325 all species →	Molecular Function	transmembrane transporter binding	Interproscan
GO:0048167 all species →	Biological Process	regulation of synaptic plasticity	Interproscan
GO:0048788 all species →	Cellular Component	cytoskeleton of presynaptic active zone	Interproscan
GO:0048791 all species →	Biological Process	calcium ion-regulated exocytosis of neurotransmitter	Interproscan
GO:0050806 all species →	Biological Process	positive regulation of synaptic transmission	Interproscan
GO:2000300 all species →	Biological Process	regulation of synaptic vesicle exocytosis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15297	RIMS2, RIM2; regulating synaptic membrane exocytosis protein 2	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_014377-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

25.7Max TPM

10.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.33	17.74
polyp at pH7 6	18	18	8.32	13.14
coral polyp · control treatment	16	16	13.14	25.69
coral polyp · oil and dispersant treatment	16	16	9.19	15.37
coral polyp · oil treatment	16	16	10.30	18.60
coral polyp · dispersant treatment	16	16	10.99	21.77
Polyp	10	10	5.06	10.43

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.74
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.58
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.58
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.55
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.36
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.14
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.50
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.83
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.18
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.33
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.25
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.91
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.16
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.06
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.66
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.05
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.23
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.87
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.14
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.29
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.15
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.02
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.98
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.14
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.84
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.56
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.28
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.19
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.15
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.86
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.12
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.97
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.79
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.32
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.54
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.41
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.69
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.84
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.30
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.25
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.55
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.07
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.11
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.83
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.27
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.24
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.76
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.44
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.90
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.11
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.35
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.58
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.37
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.67
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.45
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.87
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.67
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.19
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.15
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.11
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.58
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.42
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.25
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.96
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.47
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.29
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.41
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.17
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.60
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.07
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.52
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.86
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.47
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.62
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.92
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.60
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.34
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.25
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.83
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.85
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.24
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.82
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.27
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.50
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.77
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.18
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.06
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.69
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.81
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.39
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.85
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.51
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.36
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.64
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.32
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.32
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.43
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.96
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.73
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.83
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.43
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.97
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.31
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.39
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.47
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.38
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.78
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.80
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.79
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.26

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.