Gene detail

Detailed information of OS493_014410-T1 in Lophelia pertusa

Genomic Location: scaffold_41:434021...448667
NR annotation: KAJ7361769.1, ubiquitin-protein transferase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_014410-T1

ATGTTTGTACAGGAGTTTTGCTCAAGAATGCGACGACGTCCTCGTAAACGACTCAAAGAAAGGGATGTTGTAGAAGATAGTAATGTTTGTAAGCTGTGCAAAGAAGGACCAGATGAAGAATTGTTTGGGAAATTGTTTGTGGATGAGAACAGCGGTTTTAAAGTTCACCAGTATTGTATGTTCTTTTCCTCGGGATTGGCTCAAAGAGGAGAAGATAACGAGGGGTTTGATGGGTTTCTAATTAAAGACATCAAAAAGGAAATATCAAGATCAAAAAGACTGAGATGCAATGAATGCAGAAACCCTGGTGCGACAATTGGCTGTTGTGATGCCAGATGTCACCAAACTTTTCACTATAAATGTGGAAGACAGAGAGGAGCCCTCTTTCAATTCTTTGATTGCTTCAATTCTTTTTGTATGACCCACCGCCCAAGTCAGCATGTCAATTTGGCTTTAAGTTCAAACCAAACGTGCCCGATCTGCTGGTGTAAAATAGAGTGGAACAGTAAGACGCCCATCTCAGACACACCCCTCGTCACACCCTGCTGTAAATCAACATGGTTCCACAACAGTTGTCTTCAGAGCCATGCAAAGTCAAGTGGCTTGTATTATTTCCGTTGTCCAATTTGCAATAACATGGATAAATTTCAAGAGGAAATGAAAAGAATGGGTATTTATATCCCAGAACAAGATGCCAGTTGGGAGAAAGAAGATGCATTTGCTGACCTTCTGTTTCAGTACAGCCGCTGTGATGCTAAGAAGTGCATCTGCCCACATGGCAGAGAACATAAAGAAACTGCTGGAAAGTGGCGCATACGTTTGTGTGACATATGTGGTCAAACTGGAACGCATTTAAAATGCCAACACTGGAAGAAATCACCGGGAGAATGGCACTGTGACGTGTGTGGAACCATTCAGCCTTATTCCAGTACGCGGCGAAAACCAGTAGGTGATCGCTCGATGGATCTTAGTGATAATGATGACGACGATGATGATGAGAGCTCGTCAGCCGAGGATGGTGACGTTAATGTGTGTTCTGTGTCAGATGATGAGACTCCTCTCTCAGTTATCAAGACGGATATAAATAGTACAAGAGATGCCTCTGAAGACAGCACCAGGGAGCATGTCAGGGAAGGGGCGTCTCCCATGAGGAAGCGCCGTCGACTTTCCCTGCTAGGAACAAGTGGTAACGCTGGAACAAGTGATCACAAAGAAGATCACTTAACAAAATCCCAAGACACTGCAACATCCAGTGGTCTTCGATTCCATGATATTTTAGATTCAACATCAATGACTTCATGTTCAAGTCTACTACTTGCTTTTTCCGATGCAGTATCCACTGTATGGGGAGGTCGTTCAGTTACATGTCCACATCAAGGGTCAGCTAACATGGCTAGACAGAAAAGCGTTAAAATGGACGGTGAAGCAATTGTGATAAGAGATACAGATTCTGACTCATCAGAAGTAGAGTTGATAAATCCAGGAACTAACTTTGATCGAACAAACTTGACCAGAAAACCCATCAATAAACACAAGAAAAACACAGAAGCAGGCGACACTTGCTCAAAATTCACTGAGTCAGTTAATATCGCAAGAGTTAAAAGTCCCGGCAAAGGAAAACAACATCTGAGAATGTCGACGGGGAAGAAAAGTACATTTAATGTTGCAGAAGCTGATTCCAGTGCTCCTGAATGCGGAGAGACAGCGTCACAAGGAAATTTGCCGCGTTTGGAGAGCAAGCAAGAGCCATTTGACAGTGACGATGATGAGTGTCTTATCACCAACGTTGTGAAGAAATCCAAGAAATCCTGCCCAGTCGGTAATGATAAGCTGGGTATGAAGTGTTACCTTGATTGCTGTAATCCTGCACGATATCATCACCTTCATCACTCTTCTTTTAAATTCAAGGATTTACAAAGCAAAACAGTCAGTAGTACAAGCTATTGTGATCATGTTAAAGAGAAATCAAGCAAAGCCGTGGAACAAAATCTACTCTCAGACAAAGCAACCGCAGTGGTCAACGATGAAGAAAAAGTCGACGCCTGTTCAATTGGTACAAACACTCCGCCTTTTAAACCGTCTTCCAGTAAAGAACTGACATCCACACAAACTGGAACTACTCAGTTATACTTTCCTGTAGGAAAGACACCAGCTTCTCCATCTGGTGGAAAGAAAAGACTGAACTTGCGCAGCAAGAAGTCTGGCAGTTATCTGAAAAAGTTTTGCGCCCTTTATGAAAATCAAATGCCTGTTAATCACAAGTGTTCCAGATAA

Transcript

OS493_014410-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5F4A1	G2/M phase-specific E3 ubiquitin-protein ligase OS=Gallus gallus OX=9031 GN=G2E3 PE=2 SV=1
Q5RJY2	G2/M phase-specific E3 ubiquitin-protein ligase OS=Mus musculus OX=10090 GN=G2e3 PE=2 SV=2
Q7L622	G2/M phase-specific E3 ubiquitin-protein ligase OS=Homo sapiens OX=9606 GN=G2E3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004400 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13771 all species →	zf-HC5HC2H	PHD-like zinc-binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR034732 all species →	Domain	Extended PHD (ePHD) domain	Interproscan
IPR011011 all species →	Homologous_superfamily	Zinc finger, FYVE/PHD-type	Interproscan
IPR042013 all species →	Domain	PHF7/G2E3, ePHD domain	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR051188 all species →	Family	PHD-type Zinc Finger Domain-Containing Protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12420 all species →	PHD FINGER PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_014410-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_014410-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

23.1Max TPM

7.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.13	9.14
polyp at pH7 6	18	18	6.67	9.50
coral polyp · control treatment	16	16	8.85	18.99
coral polyp · oil and dispersant treatment	16	16	9.09	23.06
coral polyp · oil treatment	16	16	8.47	12.10
coral polyp · dispersant treatment	16	16	6.09	17.84
Polyp	10	9	3.55	8.69

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.14
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.67
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.02
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.00
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.81
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.21
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.55
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.01
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.99
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.93
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.92
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.82
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.76
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.74
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.20
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.01
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.89
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.69
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.50
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.40
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.05
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.43
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.28
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.47
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.45
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.03
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.63
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.62
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.61
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.06
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.92
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.68
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.74
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.74
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.26
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.18
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.99
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.24
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.54
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.48
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.98
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.62
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.78
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.74
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.72
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.44
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.62
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.60
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.48
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.36
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.06
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.83
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.97
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.86
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.65
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.78
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.15
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.65
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.85
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.27
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.12
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.94
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.67
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.14
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.91
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.63
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.10
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.41
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.99
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.97
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.93
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.70
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.34
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.15
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.13
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.03
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.34
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.08
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.50
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.41
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.43
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.98
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.84
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.33
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.05
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.91
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.86
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.65
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.51
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.40
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.89
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.61
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.75
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.19
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.96
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.13
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.88
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.52
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.69
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.85
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.70
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.68
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.56
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.30
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.99
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.58
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.19
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.