Gene detail

Detailed information of OS493_014440-T1 in Lophelia pertusa

Genomic Location: scaffold_41:745800...754607
NR annotation: KAJ7361799.1, Disks large 5 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_014440-T1

ATGCGTCCAAGCCCACTAACACAATCACCACATCTTTCAATGCTGGTGCAGAAGGAAAGACCAACGCCGCCGATGAGAAGCTGCTCTTACATGTCAGCCATCACTTCACCTCCTCAATCAGACTCTGCACCTTCTGCGAGAAATTACCAGGTACCTCTGGGAGGCAGTCCAGCATCGTCCAGTTTTGGACGTTATTCTAGTCATGAAGACCCTTTGGCGTTAACTCCTCCCAAGTCTAACATGTCAGGACCCCCTGTAACAGTTGCTGTATTGAGATCAACTAGTGTTCCATACTACACAGCTAAAAGCCATTCAGTGCACTGTTATGGTGGCATAGCTGCCATTAGTCAACAATGTTTACCAGTACAATGCCGCAGCAAGCAGAAACGAGGAACATTTCAGCTTGAGTCATTTGCTCCTGGCCGACATAGTCGTCAAGGTTCATCTCATAGTGCCGATGGTGATGAACGTAAAGTGCGACACTTGTCCCTTTATAGTCATGACCCACCATCAAACACTAAGAACAAAGTTCACAGAATCAGTCTACCTGCCCCACGGACACGCGTGATGTCATATCCAAGCGCAGGGACAGGGAGCTGTTGTAGCAGTTCCATGAGCTCAACACACTCCATTTCGTCAGGTCATACAACTCCTGTTATGATTCCATCAACTCCAATTGTACCGGCAACTGAAGGTGGCCCAGCGCTGGCATTTGACTTCAGTGGTCCACTAGCATCAAAGGAAGATCCTTTGAACAGGGATTATGAGCCTCACCTTGTACACATAGAAAAGAAGGACACTCTCGGAATTTCCCTTGCTGAAGGTTGTCAGGGGGGTGTAGTTGTCTGTTCAGTAAACGAAGGAAGTGTGGCTGCCAAGGCAGGACTCAAAATTGGTGATCAGCTATTGGAGTACAATGGTGTGAACTTGAGATGTGCGACTTGGAAGCAAGCTGCCACGATTCTGAAGCAGTCCGGTACCAATGTGACTATTCTAGCGCAATTCAACCCAGAGAAGTTTAAAGAGCCTGCAGAATCGTTATCCAGCCAATCGGAAGCAAGTACCACGTGCAGCACACCCGTCAACAAAAAGAAACACAGCAGCAGTACTCCGCCAATCAGAAGGAACGGAGGAATTCTGCCAATGATTAACAATGAACCCCCAGGGGACTTACGTTATGTATTCTTCACGAAGAGTCCAAGTTCATTGGGATTTAATATCGCTGGTGGTAATGCCATGGGGATCTTTGTGTCGGAAATTCAACCTGATGACGAGGCTGCTAGTTCATCTGGTCTCAGTGTTGGCGATCATATTTTAGAACTCAATGGTGTTGATTTAACTTCAGTCACTGCAGAGCAGGCCATGTTAGAGTTGTGTAAACCTACCGAGACAGTTCAGATATTGGCGCAGTATAACCCCACAAAGTTCAATTCCCTTAGAGATCAACCTGGAGATTCATTTTACGTCAGGGCCCTGTTTGAACGTGCAACGAACTCCAAAGGAGAGCTTAACTTCAAGAAGGGTGACATTTTGTATGTCACTGATACAATGTTCAATGGCTACATGGGCTGCTGGAGAGCCTGTCTTGTCAATGACGAAGATGCGCAGAAGAGAGAGATTGGAATGGTACCAAGCCGTATGAAGGCCGAGCAGGAGATTCTGTTGCGTAGGAGCCTGGCACTAGCTCATGGCGATGATTATAAACTTAGTGGAAGACGAAGTTTCTTTCGACGGAGTAAGAAAGGCACACACGGCTCGTCTGTCAATCATTCACGGGAAGGAAGTGACTCTGCTACTAGCATCACAACCAGTTGTACAGATCTTGGAATAGCTTCTTACCAGAATGTGGAAAAACTGGACAGTCACATTCCACGAGCTGTGATACTGTTTGGTCCGATGATTGACGTGTTGTATGAGAAGCTGTGTGAAGAAGTTCCATACAAGTTTGTCCAGTGTAAACCAGAAGTTGTAAATTTACCGGAAGAGAAGGTAGAGAAAGGAATAGCAGATGGCACATTTGTGGATTACGCCTGGAAAGGACATCAGCTTTCCTGTACAACGATGGCCTCAATCAAACAAGTTACTGACAAGCATTGTTTACTGGACGTCAGCCCATCAGCAGTAGAGCGGCTTCATGCGTTACAAGTCTATCCCATAATACTCTTTGTCAAGTTCAAATCTCCCAAACATATCAGGGATCAGAAAGATGGTCGGTACATCAGAGAAAAGATGAGCCTCAGACATGCAAAGGACCTGTTTGAATCCGCTTCTAAAATGGAACGAGAGTTTAAGCATTTATTTAATGGTGTTGTCCATGGAAACAACATCGGCAGCATTTGTTCCCAGATCCAAGAGACGGTGGACGAGCAGCAGAAGAAGACGGTCTGGGTACCACTCTCCGGTGTCTAG

Transcript

OS493_014440-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8TDM6	Disks large homolog 5 OS=Homo sapiens OX=9606 GN=DLG5 PE=1 SV=4
E9Q9R9	Disks large homolog 5 OS=Mus musculus OX=10090 GN=Dlg5 PE=1 SV=1
O62683	Tight junction protein ZO-3 OS=Canis lupus familiaris OX=9615 GN=TJP3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003808 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00595 all species →	PDZ	PDZ domain	Domain	Interproscan
PF00625 all species →	Guanylate_kin	Guanylate kinase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001478 all species →	Domain	PDZ domain	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR008145 all species →	Domain	Guanylate kinase/L-type calcium channel beta subunit	Interproscan
IPR008144 all species →	Domain	Guanylate kinase-like domain	Interproscan
IPR053004 all species →	Family	MAGUK Family Regulators of Signaling Pathways	Interproscan
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR036034 all species →	Homologous_superfamily	PDZ superfamily	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46360 all species →	DISKS LARGE HOMOLOG 5	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0035331 all species →	Biological Process	negative regulation of hippo signaling	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_014440-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_014440-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

111.3Max TPM

42.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	33.37	54.23
polyp at pH7 6	18	18	33.85	50.32
coral polyp · control treatment	16	16	42.97	84.50
coral polyp · oil and dispersant treatment	16	16	71.28	111.35
coral polyp · oil treatment	16	16	46.38	64.11
coral polyp · dispersant treatment	16	16	44.66	111.08
Polyp	10	10	20.57	36.58

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	54.23
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.69
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.95
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.98
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.25
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.07
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.01
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.74
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.94
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.51
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.61
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.71
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.62
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.98
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.00
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.10
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.27
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.95
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	50.32
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.10
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.93
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.32
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.81
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.68
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.94
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.68
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.59
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.40
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.28
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.88
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.69
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.67
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.89
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.15
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.90
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.13
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	84.50
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.23
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.94
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.26
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.89
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.31
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.39
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.87
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.33
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.32
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.71
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.32
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.00
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.72
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.24
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.48
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	111.35
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	107.58
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	98.62
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	88.79
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	85.48
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.36
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.33
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.85
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	66.42
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.98
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.97
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	55.16
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.30
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.69
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.92
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.62
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.11
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.92
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.48
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.74
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.52
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.10
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.61
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.93
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	48.10
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.42
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.94
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.11
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.50
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.08
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.55
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	111.08
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	69.09
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	62.94
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.02
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	52.56
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.31
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.37
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.55
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.52
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.16
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.46
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.76
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.17
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.52
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.44
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.59
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	36.58
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	32.56
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	26.93
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	26.76
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	25.70
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	15.43
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	15.41
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.14
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.42
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.78

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.