Gene detail

Detailed information of OS493_014652-T1 in Lophelia pertusa

Genomic Location: scaffold_42:262113...288822
NR annotation: KAJ7334342.1, Spectrin alpha chain, non-erythrocytic 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_014652-T1

ATGGCAGAGGTTGAGGCTCGTCAAATAGCCATTCTAGAAACTGTTGAAGACATCCAAAGTCGGCGTGAACAAGTTTTACGGCGCTATGCGGAGTTCAAAGAAGCGACTCGAGTACGGCGCCAGCGTTTAGAAGATGCGAAACGCTACCATCAATTCAAGCGTGATGCCGATGAAGTCGAAGCTTGGATCAACGAGAAACTTCAGATCGCCTGCGATGAATGCTATAAGGATCCAACCAACCTTCAGGGAAAACTTCAGAAACATCAGGCTTTTGAAGCAGAGATCTCAGCTCACAGCAACGCAATTGTTGAACTTCAAGACAATGGCGAAGGGATGATCAGCGAGTCGCATTATGCCTCTGATCTTATCAGGGAGCGCCTTGATTCCCTCATCAGGCTGTGGGAGCTGCTGCTTTCCAAGTCAGCGGAGAAAGGCCGCATGCTTCTTTTCACCCAGAAGAGAGTTCACTTCCTTCATGAAACAGAAGAAGTCATGTCCTGGATTTTGGAGAAGGAAGCAATTGCCACTTCAGAAGAGGTCGGAAGAGACCTGGAACATGTTGAAGTTCTGCAGAAGAAATTTGAGGACTTCTTGAAGGATATCCAGGCAAACGAGTCAAGGGTGACATACATCAACGATCTCGCTCATCAACTTGGTGATGAAGGTCATCCTGACATTGAACTGATTAGTGCAAAGCAAACGGAAGTTAACGAGGCATGGGAGAGACTGAAAATGCTGGCATTTAAACGTCAGAAAAGACTTGCAGGGGCTCAGGAGATTCACAGTTTCTATCGCAATGCTGATGAAACCAAGAACTGGATCAATGAGAAGGACAAAGTACTGTCATCTGATGACTATGGAAAGGATCTTGCCAGTGTCAATGCCTTGCTACGAAAGCATGAAGCTTTAGAAAGAGATTTGGCCGCTGTGGAAGATAAGGTCACAGCACTTGCTCAGGAGTCAGATCAGCTGCAAGAAGCCCATCCAGACAGTGCTGATGAAATTGCTGCTAAGCAAGATGAGATTGTCACTGCATGGGGAAACCTCAAGGACAAGTCTGGAGTACGAAAGACAAGGCTAGAGGACTCTTACCGGCTTCAAAGATTTATCTGTGACTACAGGGACCACATCTCATTTATAAATGAAATGAAAGTCTTGATCCAAAGTGATGAACTGGCAAAAGATGTTGCTAGCGCAGAAAGTCTTCTGGAGCGACATCAAGAACACAAGGGTTATATTGATGCTTCAGAGGATGGATTCAGGAAGTTTGCTAACGATGGAGAAGAACTTGTCAATTCCAACCATTATGCTAGTGATGAGATCAAAGAAAAGCTGACAAGCCTGGAAACAGAGAAGATGGAACTGCTGGAGCTGTGGGAGAAGAGACGTGTCCAGTTTGAGCAGTGCATGGAGCTGCAGCTGTTTAATCGGGATTGTGAGCATGCTGATGCTACCATGACTAAACAGGAGGCATTCCTTGCTGATGATAACCTTGGGGATTCCCTTGATGGAGTGGACGCGTTAATCAGGAAGCATGAAGACTTTGACAAGTCTTTTGCTGCCCAAGCAGAGAAGATCAATAGCATTGACGAGTATGCAAACCGCCTCATTGACAGCAATCACTATGCATCAGACGAGGTTCGTCAGAGGAGAGATGGAATAGTGGAAAGACGTCAGAACATCGAGGAGTTGTCTAAGGCTCGCAGGTCAAAGCTTGAGGAATCTCGTAAACTGCAGCAGTTCGAGAGAGATGCTGATGAAGTCAAAAGCTGGATTACTGAAAAGCTGAAGATTGCTTGTGATGAATCTTACAAGGATCCTACCAACCTGCAAGGAAAACTCCAGAAGCACCAAGCCTTTGAAGCTGAGCTGAATGCCAATCAAAGTCGACTTGACGCAGTGGATAACACTGGAGAACAGCTGATTGGAGATGAACATTATGCGTCAGAACAAATTAGAGAAAGGCTTGATGAGCTGCACAAGTTGTGGTCCTATCTTTTTGAGAGATCAAATGATAAAGGGCAGAAATTAAAGGAAGCAGCACAGCAACAGCAGTTCAACCGAGGTGCCGAGGATGTTGAATTGTGGTTCAGTGAAGTTGAAAACCTACTTGCCCTTGAGGATGTTGGGAAGGATCTGACAAGTGTACAGAACCTTCAAAAGAAGCATGCTATGATTGAAGCTGATGTTATCGCCCGTGCTGAGAAGATTGAAGTTGTGAATGCACAAGCTGATTTGTTTGCTGAGGCCGACCACTTTGATGCTCCTACTATCAACACAAAGAAGGAAGCTCTTAATGCCAGATACCAGCTGATTCAGGCTCCTCTTCTTGCTCGTAAAGCTAAGCTTGCAGATGCAGAGAGGCTAAAGCGATTCCTTCATAATGTTGAAGATGAAGAGGCTTGGATCAGGGAGAAGGAACCTATTGCCTCATCTAAAAACACTGGCCGAGATTTGACTGGAGCCCAGAATCTGTCAAAGAAACACCAGGCATTAATGACTGAAACTGGTAGTCATGAACCACGCATCAGAGCTGTGTGTGACAATGGTGTGCAGATGATAGATAATGGGCATTTTGCTGCTGATGAGATCAAAGAGAAGATTGACGACCTTGACCAGAAATGGCTTGATTTCAAGGACAAGGCAGCTGTACGAAAAGGTCATCTGGATGACTCACTTCAAGCTCATCAGTATCTGGCTGATGTAGCTGAAGCGGAATCCTGGTTGAAGGAGAAAGAACCCATTGTCACCAGCGATGACTATGGCAAAGACGAGGATAGTGCACAGGCGTTGTTGACCAAACATGATGCTATCATGTCGGACTTGAGAGCCTATGGAACTGTTGTCGATGGGTTGAGAGAACAGAGTCAACACTGTAAGCCTTCAGCTCATGTCACAGACATCTCCGACAAGGAATGTGTGGTTGCACTTTATGATTACCAAGAAAAGACAGCTAGGGAGGTCTCCATGGAGAAGGGAGACATTCTTACCCTCCTGAATTCTAGCAACAAGGACTGGTGGAAAGTGGAAACGAATGACAGGCAAGGTTTTGTTCCTGCGGCATATGTCAAAACGATTGACTCGCACAAAGCCTCACAGGAGCTTCTCCAACAGGCTCCTGAAGTGGACTCTGTTGGTCAAAGACAGCAGGCTTTGGATGACAAATATAATGATCTGATGGACAAAGGTGAAGAGCGCAAGAGGAAGCTGGAAGACTCCATTCAGCGATACAGTCTGTTACGAGATGCTCATGAGTTGGAGTCATGGATCAATGACAAGGAAGCCATTGTCACTTCTGAGGAGGTTGGAAAGGATTATGAACATGTGGAAGCACAACAGAAAAAGTTTGATGACTTTGAGAAGGATATGATAACCAAAGAGGTGCGCATCAGGGAGCTTACCTTGCTGGCTGAGAAACTAAAAGTTGAACACTATCAAGAATATGAGATGATCCGTGAGATGATCGAGCGGTTGAAGCAAAAATGGACAAATCTTGTCACCATGTCTGAGCAGAGGAAAGAGAACCTTGACAATGCTCAGGAGATTCAGAAATTCCACAGGGATGCTGATGACACCAAGCAATGGATCTCGGAGAAGGACACTGCTCTGTCTACTTCAGATTACGGCCGAGATCTGGCTAGTGTCCAGGCCCTACAGAGAAAGCATGAGGTGTTGGAGAGAGACTTGGCTGCATTGGAAGAGAAGGTCCGTGAACTGAATGTTGAAGCTGCCAAGTTGACGTCTAGTCATCCGAATGCAGCGCAAGACATTGAATGGAAGAGACACGAGTTGGAGGAGGCGTGGGCAAATCTCAGGGAACAGGCTGCTGCAAGAAAGGGCAAATTGAGAGACTCGTATGACTACTTCCACTTCCTCAATGAATTCAGAGATCTTACTTCCTGGATCAATGGTATCATGGCACTTGTAACATCAGATGAGCTTGCAAAGGATGTGGCTAGTGCCGAGGCTCTTTTGGACAGGCACCAGGAACACCGTGCAGAAATCGATGCACGTGATAGCACCTTCCAATCTCTTGAAGATTTTGGCAAGGATTTGTTGGACAAAGAACATTACGCCAGTCCTGACATCCGTGAAAAGTTGGATACCATCGCCACAGAGCGAGAAGAACTGGAAAAGGCTTGGGCTGCTCGCAAACAGAGACTGGATGAGTGTCTGGAATTGCAGTTATTCAACCGAGATGCTGAACAGCTAGAGCAGTGGATGGCAACCCGCGAGGCCATCATTCAGAGTGAGGATGTCGGAGAAGCAGCCGAGGGTGCTGAGGCTCTGATCAAGAAACACGAAGACTTCACCAAGACGCTGGCTGTGCAGGACAAGAAGATCAATGCTCTGAAGGATAACGCTGACAGGCTGATTGACAACGATCACTATGATTCTCCTGCTATTGCCGAAAGGATTGCTGCTGTGTTGGCCAGGTGGGCTACACTTAAGGCAGCCCTTGTGGAACGCCGCTCTAAGCTGGGTGAATCTAAAACCATTCAACAGTTCAGTCGTGATGCCGAGGACATTGAGGCATGGGTCAGTGAGAAGCTTCAGACTGTTCTGGATGAATCTTACAAGGATCCAACCAACCTGCAGTCCAAGTTCCAGAAGCATCAGGCATTTGAAGCTGAAGTATCAGCCAATCAGGAAAGGGTTCTGGAGACAATTAACTTAGCGGAAGGCCTGATTGAACAGCGCAAGTGTGCAGGAAGCGAGGAGATTGTGAAGGAGAGAATCACCAAACTTCAGCAGCAATGGACGTACCTGGTAACAAAGTCAAGTGAGAAAAGTCAGCATCTGAAGGAGTCTAATCAGCAACAACAGTTTAACACCAACGTCAAGGAATTGGATTTCTGGCTCGGCGAGGTTGAATCTACCCTATCTCATGATGATTATGGTCGTGACTTGGCCAGTGTTCAGAATCTCACCAAGAAACACCAGCTTGTGGAAGCAGACATTACTGCTCATGAGGATCGCATTACAGATCTGCAAGCTCAGACCCAGAACTTTGCTGAAGTTGGTCATTTCGATGCGGACTCTTTGCAGGATAAATCCCGCATTATTGCTGATCGCTATGACACGGTAAAGGACATGGCTTCAGATCGCCACAAGAAATTGGATGAGTCCAATGCTTTGCACCAGTTCTACCGGGATGTGGATGACGAGGAGTCCTGGATCAAAGAGAAAAAGCTGTTGACAAGTTCTGAGGATTATGGTAAGGACTTGACTGGGGTGCAGAACTTGCGTAAGAAGCATCAACGATTGGAAGCTGAACTGAACACTCATGAGGCAAGAATTCAGGCTGTGCTGTTGTGTGGTCGTACATTTATTGATGAGGGACATAGCAGCTCAGATGACATCAAGGCTCGCTGTGACCAGCTGCAGGAAAACTGGGATGAGCTCAAGAATCTGGCAGAACAGAGGCAGCACAAACTGGACGAGTCTCTTGCTTACCAGCAGTTCAGTGCTAATGTCGGTGAAGAGGAATCTTGGATCAATGAAAAGAACACTCTTGTTGGAAGTGATGACTATGGTGATACACTGGCTGCTGTTCAGGGTCTCTTGAAGAAGCATGAAGCATTTGAGACAGATCTTGAGGTGCACAGGGAGAGAGTGCAGGATATTGAAGATGCTGGCAACAAGCTCGTTGAAAAGGGTAACCACCAATCTGAGTTGATTGAACACAGGATTTCATCCATCAAAAGCAAACTGCAAGAGATGGAGAGGATGGCATCGTATCGCAAGTCCAAGCTGAATGACAACTCAGCTTTCTTGCAGTTCAACTGGAAGGCTGATGTGGTAGAATCGTGGATTGGTGACAAAGAAGGAATAGCTCGGTCAGATGACCTGGGACGTGATTTGTCTTCAGTGCAGACTCTTTTCACTAAACAGGAAACCTTCGACTCGGGTCTTCAAGCGTTTGAAAATGAGGGAATCGCTCGCGTCACAGTGCTGAAGGATGAGCTAGTCCACTCTCAACACGAGCAGTCACCTGCCATCATCAAACGTCATGATGACCTTATTAGGAGGTGGGAGCAGCTGTTGGAAGATTCCAGGACTCGTAAAGAACGACTCCAACACGCACAAGATCAGTACAAGAAGGTGGAGGACTTGTTCTTGTTGTTTGCCAAGAAAGCTTCAGCTTTCAACAGTTGGTTTGAGAATGCAGAGGAAGATCTTACTGATCCAGTGCGCTGTAACTCTGTTGAGGAGATACGTGTAAGTTGA

Transcript

OS493_014652-T1

Protein

OS493_014652-T1

MAEVEARQIAILETVEDIQSRREQVLRRYAEFKEATRVRRQRLEDAKRYHQFKRDADEVEAWINEKLQIACDECYKDPTNLQGKLQKHQAFEAEISAHSNAIVELQDNGEGMISESHYASDLIRERLDSLIRLWELLLSKSAEKGRMLLFTQKRVHFLHETEEVMSWILEKEAIATSEEVGRDLEHVEVLQKKFEDFLKDIQANESRVTYINDLAHQLGDEGHPDIELISAKQTEVNEAWERLKMLAFKRQKRLAGAQEIHSFYRNADETKNWINEKDKVLSSDDYGKDLASVNALLRKHEALERDLAAVEDKVTALAQESDQLQEAHPDSADEIAAKQDEIVTAWGNLKDKSGVRKTRLEDSYRLQRFICDYRDHISFINEMKVLIQSDELAKDVASAESLLERHQEHKGYIDASEDGFRKFANDGEELVNSNHYASDEIKEKLTSLETEKMELLELWEKRRVQFEQCMELQLFNRDCEHADATMTKQEAFLADDNLGDSLDGVDALIRKHEDFDKSFAAQAEKINSIDEYANRLIDSNHYASDEVRQRRDGIVERRQNIEELSKARRSKLEESRKLQQFERDADEVKSWITEKLKIACDESYKDPTNLQGKLQKHQAFEAELNANQSRLDAVDNTGEQLIGDEHYASEQIRERLDELHKLWSYLFERSNDKGQKLKEAAQQQQFNRGAEDVELWFSEVENLLALEDVGKDLTSVQNLQKKHAMIEADVIARAEKIEVVNAQADLFAEADHFDAPTINTKKEALNARYQLIQAPLLARKAKLADAERLKRFLHNVEDEEAWIREKEPIASSKNTGRDLTGAQNLSKKHQALMTETGSHEPRIRAVCDNGVQMIDNGHFAADEIKEKIDDLDQKWLDFKDKAAVRKGHLDDSLQAHQYLADVAEAESWLKEKEPIVTSDDYGKDEDSAQALLTKHDAIMSDLRAYGTVVDGLREQSQHCKPSAHVTDISDKECVVALYDYQEKTAREVSMEKGDILTLLNSSNKDWWKVETNDRQGFVPAAYVKTIDSHKASQELLQQAPEVDSVGQRQQALDDKYNDLMDKGEERKRKLEDSIQRYSLLRDAHELESWINDKEAIVTSEEVGKDYEHVEAQQKKFDDFEKDMITKEVRIRELTLLAEKLKVEHYQEYEMIREMIERLKQKWTNLVTMSEQRKENLDNAQEIQKFHRDADDTKQWISEKDTALSTSDYGRDLASVQALQRKHEVLERDLAALEEKVRELNVEAAKLTSSHPNAAQDIEWKRHELEEAWANLREQAAARKGKLRDSYDYFHFLNEFRDLTSWINGIMALVTSDELAKDVASAEALLDRHQEHRAEIDARDSTFQSLEDFGKDLLDKEHYASPDIREKLDTIATEREELEKAWAARKQRLDECLELQLFNRDAEQLEQWMATREAIIQSEDVGEAAEGAEALIKKHEDFTKTLAVQDKKINALKDNADRLIDNDHYDSPAIAERIAAVLARWATLKAALVERRSKLGESKTIQQFSRDAEDIEAWVSEKLQTVLDESYKDPTNLQSKFQKHQAFEAEVSANQERVLETINLAEGLIEQRKCAGSEEIVKERITKLQQQWTYLVTKSSEKSQHLKESNQQQQFNTNVKELDFWLGEVESTLSHDDYGRDLASVQNLTKKHQLVEADITAHEDRITDLQAQTQNFAEVGHFDADSLQDKSRIIADRYDTVKDMASDRHKKLDESNALHQFYRDVDDEESWIKEKKLLTSSEDYGKDLTGVQNLRKKHQRLEAELNTHEARIQAVLLCGRTFIDEGHSSSDDIKARCDQLQENWDELKNLAEQRQHKLDESLAYQQFSANVGEEESWINEKNTLVGSDDYGDTLAAVQGLLKKHEAFETDLEVHRERVQDIEDAGNKLVEKGNHQSELIEHRISSIKSKLQEMERMASYRKSKLNDNSAFLQFNWKADVVESWIGDKEGIARSDDLGRDLSSVQTLFTKQETFDSGLQAFENEGIARVTVLKDELVHSQHEQSPAIIKRHDDLIRRWEQLLEDSRTRKERLQHAQDQYKKVEDLFLLFAKKASAFNSWFENAEEDLTDPVRCNSVEEIRVS

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P16086	Spectrin alpha chain, non-erythrocytic 1 OS=Rattus norvegicus OX=10116 GN=Sptan1 PE=1 SV=2
Q13813	Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens OX=9606 GN=SPTAN1 PE=1 SV=3
P16546	Spectrin alpha chain, non-erythrocytic 1 OS=Mus musculus OX=10090 GN=Sptan1 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003297 (this species only)
Ubiquitin family	UBD\|Other\|SH3 · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00018 all species →	SH3_1	SH3 domain	Domain	Interproscan
PF00435 all species →	Spectrin	Spectrin repeat	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR018159 all species →	Repeat	Spectrin/alpha-actinin	Interproscan
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR035825 all species →	Domain	Alpha Spectrin, SH3 domain	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR002017 all species →	Repeat	Spectrin repeat	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11915 all species →	SPECTRIN/FILAMIN RELATED CYTOSKELETAL PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0030036 all species →	Biological Process	actin cytoskeleton organization	Interproscan
GO:0030054 all species →	Cellular Component	cell junction	Interproscan
GO:0030864 all species →	Cellular Component	cortical actin cytoskeleton	Interproscan
GO:0042995 all species →	Cellular Component	cell projection	Interproscan
GO:0051015 all species →	Molecular Function	actin filament binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06114	SPTAN; spectrin alpha, non-erythrocytic (fodrin)	-	Cytoskeleton proteins	ko04812	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_014652-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

121.7Max TPM

63.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	73.10	96.67
polyp at pH7 6	18	18	69.37	97.51
coral polyp · control treatment	16	16	68.78	121.74
coral polyp · oil and dispersant treatment	16	16	60.55	85.61
coral polyp · oil treatment	16	16	62.66	102.34
coral polyp · dispersant treatment	16	16	60.90	104.55
Polyp	10	10	40.80	68.99

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	96.67
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	93.84
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	91.79
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	91.67
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	89.99
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	89.08
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	84.54
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	83.08
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	64.77
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	64.20
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	63.31
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	63.28
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	63.08
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	62.58
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	61.37
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	60.92
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.51
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.09
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	97.51
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	94.80
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	84.18
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	83.23
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	82.73
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	81.96
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	76.57
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	74.27
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	70.40
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	69.39
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	64.43
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	62.88
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.87
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.92
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.63
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.27
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.35
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.32
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	121.74
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	101.83
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	89.65
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	85.77
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	80.72
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	80.46
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	79.52
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.96
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.19
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.96
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.76
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.40
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.51
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.91
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.94
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.21
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	85.61
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	82.09
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	79.39
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.84
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	75.07
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.13
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.02
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.58
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.95
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.99
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.38
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.78
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.71
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.09
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.29
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.87
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	102.34
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	94.19
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	88.98
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	85.81
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	73.89
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	67.47
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.40
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.96
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.71
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.66
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.46
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.94
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.01
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.34
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.06
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.39
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	104.55
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	96.12
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	93.59
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	83.03
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	80.21
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	76.81
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	68.75
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	65.71
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	60.04
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	59.63
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.28
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.64
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.32
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.11
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.15
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.43
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	68.99
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	57.95
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	55.76
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	51.35
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	45.36
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	45.23
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	35.46
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	16.93
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	15.70
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	15.30

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.