Gene detail

Detailed information of OS493_014820-T1 in Lophelia pertusa

Genomic Location: scaffold_42:1791427...1813175
NR annotation: KAJ7334499.1, FK506-binding protein 15 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_014820-T1

ATGGGAGCTGTAGAGAGTACCGACGAGGAAAACAGTGTTATACGATTCGTGGATTCTGTGGAAATCAGGCACGAGAAAGATACTTCAAGTTATGGACAGGAACATGTCTCCACCGATTTTGTTCCTGATGGCAGAGATTGGATATCACACGTTCCTAAAGCTGACGATTCTCATGGAATTGCCACAGTCGCTCCAGCAGACACCATGCTTTACGAGGGAACCTATGAAGACTTCGAGATTCTCGGCGATACAGCTGTACAAACGAGCAATGAAGGAGACTTCGAGATAGCAGGCAGCCAAGCAGATCTAAACATCGAGGAGGAGGATGAGTCGCCTGAAGGACTGAAGTACTTCAAACCTCCGAGAAGGACGTCATATAAGAAAAAAGCTAAAGACGTCCAAGATGGCGGAAAATCGAGCTCGCGTGACAGTGTTCTGTCTGTCTTGAATAGTTCGTCGAAGCTTGCTTCGTTATTCGGTCAGGATAGAGCGTCATTCACAGGAGGAAATGAATCCTTGACGTACACAGCACCTAAACAGCCAAAGAAGGAGAAACAAGCCGGTGGTGGGGAAACAGCAATCCTGTGTGCTACAGCAGTTCATGCCTACAAATATGTTAATGGTCAATACGCCAGTCAGGGAAAACTGGGTGCCGCAGTGTTAGCAAATCATTCAGCAAATGATTACAAGATACTCATTTATGCATCTAAACAACAACAAGTTACCACAGGAAAAATCCATGGGAACTTTTCATTCACGGTACAAGGAAGTAATTATGCAAGTTTTTATGATGATCAGAGGCAAACATGGTCACTCTGCTTTAACTCAGACAAGGATATCACAAACTTTGCTAAACAGGTTGGTTTATCAAAGTTCAACTCTGCTTCTTCGACTCTTTGTACTCAAGACCTTATCCCTGGTGATGGAATGGCAATTGAACTAGGTGATGCCTTAGAAGTCAAGTATACAGGATGGTTATGGACAAATAATAATTTTGGAAAAGTGTTTGACGGCAATACTGAGACTGATAAGACATTTAAATTCAAAACAGGAAAAGGAAAGGTTATCAAGGGATGGGAACAGGGAGTGATAGGCATGAAGAAAGGTGGAAAAAGGTTAATAGCTATTCCTTCAACTCTGGCATATGGAGAAAAGGGTGTGCCTTCCAGAGTTCCTCCTAACTCTCCACTCTTGTTTGAAGTAGACGTTCTGAGGATCAAGTCAAACAGAGAGACAACTGAGTCACCTGTAACATTCCAGGAACCTGCCACTCCTCAAAACACAGATCGGCTGCCTGACATTTTGGCTGAGCCATCTGGTTCAAGAAAGAGGTCCACAGATTCAATCTCACAGCTGAGTGCACCTATTGACAGTGGAATCAAGGGTAGGACTGCATCCATCACAGAACAACTGTCTCAGTCTCCAGAGAAAGGGACAGACAAGGCTCGCTTGCTTGCTAGAATGTCAAAGATGGGAAAAAATCCATTGTCCATTCCTGGAGCTGTGGCAGCCGAACCTGAAAATTATGACATGATGGTAGAATCGGAACAGGAGATACCTCCTAGTGCCGAGCCCCATGTACGCGACAGAACAGAGAGTAACACAACAAGCCCACCACCCATAAGCTCTAACCCACATCCCAACGTACGAGCCAAACCTCATCCACCTCCAAGGCCAGCGTCTTTTCAAGTTCATCCTGAAGTTCATCAGCCAATTCACAATCCTGCACCTCCTGCGCCGCAGCCAATCCAACAGCCTGTTATGAACCCACAGCCAATGATGCAGCCAGCGTTCACGCCACAACAGCAGGTTGCACTGTATCAGCCACCCATGAGCATGCCGAGCATGGGGTATCCTATGATGGCACCCCAGCCGCATATTATAACTGCACCATATGCAGTCCCACCTCCACCTGCCCCGCCTCCTCCCCCACAGCCTACTGCTAATGATGCAATGGTCCCTGTGCTTATGGCAGAGACACGGCAACAACAGGGAGAAATACGCATGTCTATTGGCAAGCTGTCGGACAAGATTGACGAGCTTTCAAACAAGGTTGAACGTCATCAACAAAGCTCAGGTCATATGGCCGGACAGCTGACTCCTGTTGGTCAGATGGGAGTTGGTGCATTTGGTAATCCACAAGCTGCGATGGAAGCTGCTGTTTTAGTTCACAACATCAACAGAATAGTGCAGGAAAATGAGAAATTGAAAGCCGAAGGTACAGAAAAGACCAAGAAGATCGAGCTGCTTAACGACAAGATATCAGACTTGCTGCAGAAGAACCAGAGATTTGTAGAACAGAGCAACACAATGTTGGAACAGAGGAGCGACTCTTTGCAAGTAAACTCGGCGCAGTCACAAGCACGAGTGTTATCACTAGAACAAGAAAGGATATCCATGAGTGGGGAACTGACAACAGCCAAGACGCACTTAGCATCACTTCAGAATGAAGTCACATCTCTTCGCCAGAAAGAGGCAGAACTTAGCAGTCAGCTTAGCAAAGTGACGTCAGAAGCTGAGAAATTCAGAAATGAATTGACACGTACTAAAGATTCACACACAGAGAGTGCTGAACAAGGTGATAAACTGAAACAGAGTCTTAAAGAAGAAAAACAAACAAGGAAAAGACTGGAAAGCAAAGTTGATCACATTGAAGAAGAACTAAATGATTTAAAACATGAAAAAGAGACTTTAGAAAGGGGTCTTGGAGATCGGAAGAAGAAACATGTGGCAGATAAGAAAAAGTTTGAAGAGGAGCTCGAGGAACTGCGAGCACAACAAGAGGAGGAAATAAAGTTCTTGAAGGAAAAACACAGAAAAGAGAAGCAAAGCAGTGGATCAGTCACAGCGAAACAGGTCTCGCAGGCTGAGGCAGAACTTGAAACCAGGTGGACAGAGAAAGCAGAAAAAATGGTTGCACAGACGGAGGAAAAATGGAAGAGACGATTCCAGGAAGTTTCTGATGAAAAAGAGGAGACATTCCAAAAATTGGCGGAATTTCAAGAGAAGTGTTCAACACTAAAAACAAGAGAAGATGAACAGGACGAAAAGATTAAAGATCTCCAGGAGAAATTAGAAGACCTTGAGGGAATACGAGAAAAGTATACGCGACTTCAGGCTTCACAGGGCGACAAGGACTCAGAGATGGAAACCTTACGGACAACACAACAAGAGCTAGATGCACTACAGACTAAGTATCAAGAGGTTCGCTCCAGGACACTGAAAATGAAGGAAAGATTCGAGGAGCAACTGGCATCTGCCGAAGAGGAGCGCGAATCTGCAGTCTCAGAAGCGTATAGCAAAGGTGTGAAGGAAGGGAAAGAACAGGCTGGCGCCAACAAAGAACAACCCTCTGTTAATGTGGCAGATGAAGTAAAGCGGATCATGAACACTGTGTTCTATATGCTGAGGAGTGAATTTGAGGCAGATGACACTTACACAGGCTCAGACATCATGGCGGTTATACTCAAGACTATCAAGGAGGTGACCGTGAAACTCGTGAGTGGAAAATCAGTGGAGAAGAAAGACAGTGAAGGAGAAGAACAAGAAGAAGAAGATGATGAAGAAGAAGAAGAGGAAGAAGAAGAAGAAGAAGCAAAGGATGAAGACGAGGACGATGAAGAAGCAGACGATGAAGAAGAAGATGATGATGAGGAGGAGGAGGCGAAAGTAGAGGGAAAAGAAGAAGAAAAACTTGTAAATGGAGAGTTAGTTGAGAAAGAAGAGAGCGAAGACGAAGATGAAGAAGAGTCGGAGGAGGAAGAGGTAGAGGAGAAACACAAGCAGATTAAACAAGGTGTTGATGAAGTGGATGAAGAAGATGAAGGAGACGACGAAAAAGAAAGTAGTACTGCGGTTACAGAGGAAGAAAGAGAAAGTGATAATACACAGAAAGAAGAACTAGGGGTGAACGTTGAACAGCAGATGGAGCAAAAAGAGGATTTAAAAACCAGCGAGGAGAGCAAACAAGATGATAATTCTGTTGAACCAGAAGTAGTTATCGAAGATTCTAATGATGGTATTTTAGAAAGTAGTAATGGTCCAGAAAGCAAAGAAAACATTGACAATACAGACAATTCTTCAGAAGATGACTCTTTTCAAGGAAATCAAATAGATGTACCTTCTTTAGAAGAGCTTTCTGAGGAGGCAGATGACGAGAACTCTAGAACTGAATTAGACAGAACTGTCGACTCCTCCCCAGAAAATGTAGCGCAGTCTGTACCGGACGAAAGCAAAGAGAGTCCGCCAGAACCCTTTCATATTGCTGTAGCTGAAGAAAAAGAGGAACTACCAAAGGAAGAACAAGGAACACAAGAAGCCCAAGTGGACACGGCGCAGAGCAACACCACAAGTGAAGATAAACTTAAATCATTGTTTGGTGATGATGGACATGACGATGTGGAAGCGACGTTTGGATCGTTGTCAAAGAAAAAGGAAGAGGAAAAGCCGGATTCTCCGCCACCCCGTGACGTACCACCGCCATTATTTGATGACGACGATGATGATGACCTTGATTGGTTTAAGTGA

Transcript

OS493_014820-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6P9Q6	FK506-binding protein 15 OS=Mus musculus OX=10090 GN=Fkbp15 PE=1 SV=2
Q5T1M5	FK506-binding protein 15 OS=Homo sapiens OX=9606 GN=FKBP15 PE=1 SV=2
Q54G21	FK506-binding protein 5 OS=Dictyostelium discoideum OX=44689 GN=fkbp5 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002998 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00568 all species →	WH1	WH1 domain	Domain	Interproscan
PF00254 all species →	FKBP_C	FKBP-type peptidyl-prolyl cis-trans isomerase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001179 all species →	Domain	FKBP-type peptidyl-prolyl cis-trans isomerase domain	Interproscan
IPR000697 all species →	Domain	WH1/EVH1 domain	Interproscan
IPR046357 all species →	Homologous_superfamily	Peptidyl-prolyl cis-trans isomerase domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR44927 all species →	FK506-BINDING PROTEIN 15	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003755 all species →	Molecular Function	peptidyl-prolyl cis-trans isomerase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17478	FKBP15, WAFL; FK506-binding protein 15	-	Cytoskeleton proteins	ko04812	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_014820-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

63.7Max TPM

37.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	40.55	51.13
polyp at pH7 6	18	18	42.30	57.77
coral polyp · control treatment	16	16	42.94	63.72
coral polyp · oil and dispersant treatment	16	16	34.22	48.30
coral polyp · oil treatment	16	16	39.91	48.15
coral polyp · dispersant treatment	16	16	28.86	40.37
Polyp	10	10	24.49	38.23

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.13
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.94
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.27
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.69
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.99
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.81
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.46
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.87
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.80
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.04
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.76
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.07
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.61
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.98
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.17
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.05
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.71
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.58
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.77
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.25
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.50
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.89
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.23
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.38
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.90
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.53
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.78
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.61
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.49
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.79
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.32
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.22
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.08
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.91
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.90
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.79
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	63.72
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.51
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.50
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.09
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.69
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.72
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.65
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.16
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.29
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.64
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.51
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.16
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.15
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.05
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.79
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.38
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.30
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.34
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.81
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.79
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.04
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.92
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.77
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.34
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.04
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.70
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.57
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.89
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.52
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.55
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.52
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.42
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	48.15
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.73
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.55
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.04
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.43
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.67
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.21
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.75
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.64
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.61
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.33
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.33
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.81
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.93
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.59
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.78
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.37
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.70
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.11
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.84
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.31
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.74
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.83
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.29
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.35
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.70
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.53
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.22
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.17
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.94
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.16
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.49
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	38.23
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	37.38
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	34.97
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	28.56
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	25.40
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	19.37
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	17.01
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	16.07
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	14.67
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	13.26

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.