Gene detail

Detailed information of OS493_014996-T1 in Lophelia pertusa

Genomic Location: scaffold_43:1871969...1882592
NR annotation: KAJ7392052.1, Protein of unknown function (DUF1387) [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_014996-T1

ATGGCGAGGAAAATCTCTGCGAAACAAGGAAAAGACTTCTTTGACATTCGAAGCGGTCGAGTTCTTGCAGACTTGAATTTCGCTCAACGAAGTTCCGCAAATCCCAAAACAGAAATCGGATTCATTCGCGAAGCCTTCCCACTTCGAAGCAAAGATGACATAACCTTGGTTTTACAATCGTGCGATTACAACGTTGAAGCAGCTATTGCCTGCTTCACAAATGGTGAAGCGGATAATCTCTTAAAGGAATGGAATATCCAGGGAAGGAAGTCGAAGAATTCAAAAAAGAAACGGAATAAGAAAAAGCAGGCAAAAAATGGTGAACCTGAGACCCTGGAGGTTGCTGTGATACCACAGAACAATGAGAATGTTTTACAGCTGAATGAAAACAACAAAGATGCACCAGTCACATCTGAAGAAGATGCCAAAAAGCCACTGCCTGCAGTGACCTTGAGCCTGGAATGCCCTTCCCCGTCTCCTGGTCCGCATCTGCTTTATCCACCAACACCGTCACCATCAAGCTCTGAACTCTCCCTTCCTTCTTCCAACTCCGACCAGCAGTTGACAGATGCCATTCAAGACCCTGAGCTTGCATCCAAGCATAGACCCCGTCAGAACAATCATGCTCATGCAAAGATTGAACGGATGACATCTACAGGTCCTGATGCTCTTAAAAAAACAGTGAAGGACCTGCAGCGCTCCAGTGTTTCACTTCCAAGATTTCAGCTTCTCTTGGAAGAGGAGTGTGACAAGTCTTTCAAATATATCACCAAAACATTTCAAGAATTAAGACAATGTGTGAACAACAGGGAGACTCATCTTCTTGCCCAAATGGAAGAATTTAAGAAGCAGGCAGTTGAATTGTTGGAACAAAGACAAGAAAATGCAGCAGCCCTGAAGCTGAAGTCAGACAGAGTGGTGGAATGCCAGAGGAATTTTGTTACTGAACGGAAAATTGATGAGGAGCTGGCCAGAACAACCCGTTTTATCGGAGACAAGGATCAGCTGTTATCAACGATTGCAAATTTTGGAGGAGTTGTGCCTATTAAGAGCTGGTACAGCCCAGTCACATTAAACCCACCTCCACTACCAACTAAGAAGGCTGAAGGGAGCAGTGTTGATAAGAAAGTGGCTGAAACTGTCTCATCACCAAAAGCACTCACATCACCAGCTCCTGCCATTGTTAGTGTACCCATCATCACGGCGCCTACTGACGAGAATTCTGTGTCATCTCACAAGGCTCTTCAAGAGGTTGCAGAACTGCATGCAAAGCTCCAGGCAGCTCTTCAGCAACAAGGCTTGTCATCCTCAACTGGAAAAACTGTGGAAGGACAAAAACAATCAAAACCTGACCACAAGAAGGATACAAGGCCAAATTCAGCCTCTCAAGCACCGCGTCAACAGCAGACATCGCGGAGACCACAAACAGCACCTCCGCAAAATCAACAACAGAGCAAGGACAGAAAACAACAGGGTGAGAAGACAAGACAGAACCGCTCAGCTGAACCAAGGGTTGCACCACAACAAGACAAGCAAAATAGCAACCAATCATATAGAAACTCCAGGAGATCTAATCAACGCAGACCACCTCAAAGAAATGCTAAATCTGACATTTCAAATGAGAAGAATGAATCGCCTAAAAATGAAGCCACTCATTCATCTCCAAACTCTGAAGAAGCACAAGAACAGGTTAAGGTTGATAAAGAAAAACAATCTCAAGACAATCCTGAGAAAGTTATGTCGCAGCAACCTAAGACAGTTAAGGAGAATACACAATCAGGAAACAGGAATCGGCAGCCGCGAGAACAGAGGGAGGGTGGGGATGAAAGGCCTCGCAATAGGAATAGAAGAAGAGGTGGTAGGAGAGGAGCTTATGAGGGCCATAATGCAGCCAATGAGAAGGATCATTTGAATGTCCCAGGAGAGAAAAGCGAAAATGGTTCCCTTAAAAATGGCCCTGCTGAAAAAGGCCCTCTCAAGGAAGAAAAGGGCCATGATATCAACACTGGCAAGGACCCTGTTGAAAAGACTGCAGAAAGAAATAATGGGGCAACTGCTCCACAAGAAGGTCCAGTCGTGAATGGAAAGGAGACTGACTTAGGCAGCAGTCCTGCCGAGTGTCAAAATGGCACGAATGCCCATGTTCCAGTGAATGATGGAGGAGTGAAGAAGGAGGCACTACCTCGAAGACCAGACAGGCCATCTAGAAGGAGGGGTGCTCAGAGAGAGAAAAAGGATGGGCCAAGTCCTGGGCCAGCACCTAATAGGCACCTAAATGGAACCAAACCAGTAGAAAATGGAACAGAAGAATGTCACAGCAAGGAAGAGAGTAAGGCTCAAAGCAATGACCAGACGTCAACAGAGAGCACTCAAGATGAGACCGAATCCAAGAGAGAAAAGAATACAACACAAGAACTTGAAAAAGACTTAGATAAAGCTATCCCACCGAGAGTAAATGGGTATATACCCGTGAAAGAAATTAAAGAGGTTAGTATAGATAGATGA

Transcript

OS493_014996-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9NUQ6	SPATS2-like protein OS=Homo sapiens OX=9606 GN=SPATS2L PE=1 SV=2
Q91WJ7	SPATS2-like protein OS=Mus musculus OX=10090 GN=Spats2l PE=2 SV=2
Q5U2T3	SPATS2-like protein OS=Rattus norvegicus OX=10116 GN=Spats2l PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008125 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07139 all species →	SPATS2-like	Spermatogenesis-associated serine-rich protein 2-like	Family	Interproscan
PF02845 all species →	CUE	CUE domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR009816 all species →	Family	SPATS2-like	Interproscan
IPR009060 all species →	Homologous_superfamily	UBA-like superfamily	Interproscan
IPR003892 all species →	Domain	Ubiquitin system component CUE	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15623 all species →	SPERMATOGENESIS-ASSOCIATED SERINE-RICH PROTEIN 2-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0043130 all species →	Molecular Function	ubiquitin binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_014996-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_014996-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

148.5Max TPM

42.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	29.06	44.52
polyp at pH7 6	18	18	31.85	41.65
coral polyp · control treatment	16	16	53.04	148.45
coral polyp · oil and dispersant treatment	16	16	76.27	136.90
coral polyp · oil treatment	16	16	45.79	103.19
coral polyp · dispersant treatment	16	16	40.79	63.30
Polyp	10	10	14.78	30.35

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.52
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.03
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.54
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.74
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.39
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.92
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.90
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.22
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.73
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.56
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.03
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.43
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.82
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.60
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.91
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.73
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.45
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.57
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.65
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.62
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.08
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.89
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.06
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.79
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.90
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.30
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.24
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.76
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.54
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.59
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.45
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.98
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.93
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.67
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.80
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.02
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	148.45
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	85.29
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.79
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.74
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.62
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.92
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.38
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.69
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.54
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.85
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.59
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.19
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.75
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.88
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.17
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.73
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	136.90
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	128.47
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	104.98
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	99.26
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	97.07
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	80.61
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.39
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.38
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.07
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	64.31
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.14
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.35
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.14
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.72
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.05
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.44
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	103.19
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	85.59
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.51
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.87
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.86
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.50
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.35
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.08
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.62
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.51
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.33
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.97
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.57
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.76
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.31
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.64
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.30
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.31
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.98
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.92
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.35
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	52.03
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.65
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.17
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.08
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.49
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.18
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.60
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.47
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.76
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.59
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.68
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	30.35
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	25.83
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	17.40
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.89
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.88
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.48
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	9.85
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.62
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	8.53
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.96

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.