Gene detail

Detailed information of OS493_015262-T1 in Lophelia pertusa

Genomic Location: scaffold_45:348202...367947
NR annotation: KAJ7379479.1, Cadherin-like and PC-esterase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015262-T1

ATGCGATTAACACAGCTTTGCAGGCGAAAATATGTTGCCTTCATGTTGGCTTTGATTACAATAATGTCGGTGTTATGGACTTACTGGATTGAAAGTCGTATCCAGCACGACCCCGAAATTCCACAAGAAGGATTTCATTCCGTGGAAAGGAAAACAAAACATGAAGCAGTGGAGTTAATTGAGTTTTTGCGGGTGAAAATAACTGGTATTGAAGGAAATGAGTTAACAAGAAAGGGAGGGGAAAATGGACTTGTTCATACGCCTTGGTCCAAACTGGCGTATTCAGTTACAAAGGCAAATGTCGCCGAGAAGACAACAGAAATAGGATTGCTACAAAGGCTAAAAGAGTTGGAGAAAAACAAGTCAAAGAGCCAATCAGAAGTTTTGCTAGTCAATTCCTTTGACTCGCCTGGAAAGGATTCCTTGGAAACTTTCAAGCATGCGTTTGAAGCTCTTGAAAACAATAGGGTGTCACCAGTTCCAGGCATGAACAAATTATTTCTTAGGAATGATGGTTTCTGTTACCTTATATCTGCATCCAGGCATATCTCATCAGCTTTTAAAAGCAAGCCTTTATCACCTCCTTGCTTTGTGTTACCAGCACAGATCAAATCACTTCTTCAAGACATCAAAGAAAAAGGAAGCCAGTCCTTTACTTTTAAATCTCTTGGATCAATTGCTACGCCATTACATAACTGGGGAGCTACTGAAAGTTCTACTAGTGACAAAATAGATGACTCTCCAGAGGCTGTTGTGCAGTCCTTTCCAGGGGATGTACTTGTGATTGAAGACAAGGCTGTTATAGTGCAGGTTTATGCCCTGGTTACTTCAGTGTCTCCTCTCAGGGTATACAGACACAATGATGGACATGTACTTCTTACAGCAACAGAACAAGGAAAACCTGTTTCTTCTGAGAATTGGGACCTGGAAAAGTTTCATAAACACCTGGAAAACAATTTTGGTGAAGACAAATCCAGTGAAGCAATTGAGTGGATGGATGAACTTGTTGTGAAATTGTTACTTTTACTGGAACCGTCACTGGTAAAGGCTCTTAATTTTGAGAGAGTTTCGCAGAGAATAGTTGAAGACACTGTCAATCTATTGTTTAATATGTCGTCAGTTCCTGTTTCCCATGACATTCATCAGAGCTTGGAAGTCTTGAAGGAAACATCAATAATCAAGAACAGTCGGTGCCACCGAGTGAAGGGAACTTGTTTAACAGATGACTTGCTAGAGTATTTATTAGAAACTAAACAGGAAGCACAGCATTTAGGAAACTTTAAACAGCTTTATCCAACTCCAGATGGTCATAAGTACGAGGCACTGATACCCGAGTTGCTAGACACTGGAGTAGAGTTGCATTTTAAACAACGAACTGATTTAGGAACACCAGATGTACATGATATTTTAACAGGTTTTCAAGCGCAGATGGTGGCAGATACTTGGCGGCACAAAGGTGGTATTAAATTAACATTGACAACAGACAACTCAAGAGTATCGGAAGGTTCAGTAAAGGAAACTATGTGCAACAATGACCCAGAGGCAGACCCTGTTCTGATGGAACTCAATGCACGACCAACAGTACTGCTTCAGCCTCAGTTCAAGAGTGACGTTTTCATTTATCAAACAACTGTGTCATTTGATGCAATGGTCCTGCAGCTTTGGGGAAAAGCTTCCACTTGTCAGTCAGATGTGCGAATCAACACCAAATACGAGGAAGACAGTCAAAGATCGAACCATTCTCTAGGTGTGGGCTGGAACACGTTTTCGATATTTGTTCTTGATACCAGTAAAGCAACACCTGAAGTTGTCAATACATACCGTCTGTTTGTGTTTCGTGAAAGACGCTCTGAGACAGAGAGGACATTTGATAAAGAGGCCATGCATCAAGTTTGTGCCCATCACCAGGAGTGCAACCTGAAAGTGTTTCCTAGCATGCCTTGTGGTCTAGAGAAGCTATCGGAGACAACATGGAAATTGTTTCTCTTTAAACAAGACGAACTTCCTCGTTGTGAGACTGGGCATGAGTCAGGTCGTTGGGTTCTTCCCTGTACAAGCTGTGATGACTCTAACAGCTGTTACTGGAGAGAAGCAGTCTGGGCTCCATACTCTTGTCGGTACAATGCGTTGTCAAGGGATGATACCGGGACATGTCTTGCAAACAAGAAGATTCTTTTTGTTGGAGATTCCACCAATCGCGGCATTATGTATTACCTTATGGAGAAGCTGAATGGTTCTTTGAGAAAATGGGAAAAGACGCATACAATGAAAATTTACAGTGACGAGTTAAACGGTGGCCGTACCTCCGTCAGCTTCGCATACTACCCTCAGTTTTGGCTTCCGGAGAACAAGAGACCTGTATTTGTTAAAGCGCTCTATCAGCTTATAGCAAGGTTTCTTCCTTTAGAAAACAACACTAACACCATTCTAGTTGTGGGTGGAGTGCAATGGATGAGTTCTCAACACATAACAGAGACCAATAAAGCTCTAACCAGCCTTGGTTTGAATGGCATCAAAGTGATTATCAAGAGCCTGGGATCTGGGTTCCACCTTCCCGTGCCAGGACTTCCTCGCCACGACTTGGCAGGACAGCGAAATACAGCTAAACGGAACCAGCGAGTTATCAGCGCCGCCAAGCGGTTAGGATATGAAGTGGTAGACACGTTTGGCATGACTGTATCTAGATACAAGGACTTTCTAATGGGAAACTGTGCTTGCCACTTTCATAAGGTTGTAGATATGAGGTCATTAATCAAGGAAGAGGATGAAGTTCCGTCTCCATTACTGGATAACAGCGAGCATGATACTGACGTTTTACCCAGATACCATGTGATGGGACCCATTAATAGTGTTTACTCAGAACTGGTGATCAACAGAATGTGTAGTTAG

Transcript

OS493_015262-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A4D0V7	Cadherin-like and PC-esterase domain-containing protein 1 OS=Homo sapiens OX=9606 GN=CPED1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0009641 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12733 all species →	Cadherin-like	Cadherin-like beta sandwich domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR025883 all species →	Domain	Cadherin-like beta sandwich domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14776 all species →	CADHERIN-LIKE AND PC-ESTERASE DOMAIN-CONTAINING PROTEIN 1	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_015262-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_015262-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015262-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

39.8Max TPM

8.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.03	12.20
polyp at pH7 6	18	17	7.26	10.73
coral polyp · control treatment	16	16	8.74	14.26
coral polyp · oil and dispersant treatment	16	16	11.04	30.62
coral polyp · oil treatment	16	16	8.01	16.16
coral polyp · dispersant treatment	16	16	11.15	39.78
Polyp	10	10	4.26	8.42

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.20
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.46
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.62
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.71
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.45
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.23
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.01
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.45
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.34
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.69
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.65
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.21
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.20
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.07
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.95
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.63
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.91
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.79
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.73
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.08
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.85
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.73
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.93
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.87
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.65
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.37
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.17
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.01
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.95
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.92
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.81
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.74
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.97
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.90
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.97
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.26
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.74
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.82
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.41
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.41
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.21
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.83
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.03
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.94
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.63
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.57
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.66
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.94
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.47
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.17
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.76
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.62
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.36
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.05
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.80
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.67
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.63
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.92
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.78
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.76
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.06
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.63
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.62
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.61
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.40
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.37
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.27
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.16
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.66
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.64
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.80
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.75
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.08
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.75
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.39
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.28
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.63
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.00
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.81
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.66
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.00
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.51
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.98
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.78
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.26
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.90
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.63
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.07
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.71
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.94
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.45
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.28
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.16
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.47
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.88
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.76
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.18
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.07
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.90
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.42
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.11
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.99
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.11
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.08
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.07
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.33
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.55
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.17
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.79

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.