Gene detail

Detailed information of OS493_015273-T1 in Lophelia pertusa

Genomic Location: scaffold_45:547999...584597
NR annotation: KAJ7379489.1, ABC transporter B member 11 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015273-T1

ATGGATGGAGGGTCGGATTATCGTCCAAGAACTGCTAACCCTGACGATGAGAATAGTCTAAACGATGTTGTGGTGAAGATCGCTCCTGATGAAATGAATGGCGTACCCTACGCGAAAAGGGCCGCTGCAGACGATACAGCTGAAAACAACGATGAAAGTGATAATAAAGATACGAAAGAAGACAAGAAAGCCGAGAACCCTCCAGCTGTCTCTTTACTCCAACTGGTTCGTTTTAGTGATAAGTTAAATGTCCTGCTCATGTTACTGGGAACTATATCAGCAATTTGTCATGGTGCATCCCTTCCTCTCCAGTTTATCATCTTTGGCGAACTTATAAATAGTTTCATCGATTTTGCTAAATTTCAAACAGCCAATGTTACACAGCCATTTGATCTTGAAGGACAGATGACAAAGTTTGCATTGTATTATGTTTATTTGGCTTGTGGAACCTTGGTGATCGCCTATGGCCAAATGGGACTATGGTCGCTTACTGCCACACGGCAAGTGAAGAAAATGCGTTTGGCTTTCTTTAAATCTGTCCTGAAACAGGACATTGGTTGGTTTGACACAACTGATCCAGGAAAACTCAACAATCGACTCACCGAGGACCTGAACAAAGTGGAGAATGGTATTGGTAGCAAAATTGGCATGTTCCTTCAAGCAATCTCAACAATGCTTGTAGGTTTTATTATGGGATTTGCGTATGGATGGAAGCTTACTCTTGTTATCATTGCTGTGAGCCCATTATTGGTTATTGCAGGTGGAATACTAGCAAAGATAATGTCTTCGATGACAACCAAAGAGCTTGATGCTTATGCAAAAGCTGGGAGCGTAGCAGAAGAAGTTTTGTCATCAATAAGAACTGTTGCTGCATTTGGAGGAGAGAAGAAAGAAATTGCGAGATATACATCCCAACTGGGAGAAGCTCGGGACTTCGGCGCCAAGAAAGGTTATATGTCTGGACTCGGCTTGGGCTTCTTTCAAGTTATCACTTATGGAACCTATGCTTTGGCCTTTTGGTATGGTTCAAAATTGATCATTGGCGACGAAATAAATGGAGGACAATTGCTTATTATATTTTTTTCAGTTATGTTTGGTGCCATGCAACTGGGTCAAGCTGGCCCCAACATGGAAGCCATAGCAACAGCGAAAGGCGCAGCGTATCAAGTGTTTCTTATAATTGACAGGGTTCCTACAATTGACTCCAGCTCAAAGGATGGTATAGAACTTGACCAAAGTTCCTTCAAAGGAAACATCAACTTCAGAAACATTGAATTTTTTTATCCATCAAGACCAGACATAAAGATTTTGAACAGTTTGAACCTGACTGTTGACAGTGGACTGACAGTTGCATTAGTGGGCGAGAGTGGCTGTGGAAAGAGTACTGTTGTCAAACTTCTACAGAGATTTTATGACCCCAGTGGTGGTGAGGTAACTATTGATGGCCATGACATTCGTAATCTGAACTTGAAGTGGTTACGTGAACACATTGGTGTTGTGAGTCAGGAGCCAGTTCTTTTTGCCACCACAATAACAGAAAATATTCGGTACGGTAAAGATGGTGTGACACAGGAAGACATTGAAAGAGCAACAAAGATGGCTAATGCTCATGATTTTATCTTGAGCCTTCCACAAGGCTATGATACTCTAGTTGGTGAACGTGGAACTCAGTTAAGTGGAGGACAGAAGCAGCGAATTGCCATTGCACGAGCTCTTGTTAAAGATCCAAGGATATTGTTGCTAGATGAAGCAACTTCAGCACTGGACAGTGAAAGTGAATCAATTGTACAAGCTGCTTTGGATCAAGCTCGTCAGGGTCGCACAACCATTGTGATTGCTCATCGTTTGTCAACAGTCCAGAATGCGGATGTTATTGCAAGTATTCAGGAAGGTGTGGTGGTTGAGAAAGGAAGCCATGATGAGCTCATGCAGACTGATGGAGTCTATCACCAGCTCGTCACATTACAGACATTTGAAGAGGAGAAAAAAGAGGATGGTGTTCAGGATGATGATAATAATGACGAGGCAGAGAATATCGAAGCAAAAGAGTCATCAGCAATAGTGAACTTTACTCGTAGTACGTCACACATGTCGAATGACAGCGAACATGAAGAACAGAGAAGGGGAACCTCAGTTCTAGACAGGCCCAAATCTGACAAGACTGAGGATAAGAAAGACAAGGATGGCAAAGATAAAATTTTAGAGGAAGACGTAGAACCTGCTCCAGTGATACGCATCATAAAGTTGAATAAAACTGAATGGCCTTACCTGCTGTTAGGAAGCATTGCTTCCATCATAAACGGACTATTTCCATTCGCATTTGCAATGGTTTTGTCAGAAATTCTTGCTGTATTTTCCTTGAAAGATAAAGAGAAGATGAAAAAGGAATCTGAATTCTGGGCTCTGATGTTCATTGCCATTGGTGTGACGAGCTTTTTCTCTAACTTTCTCAATTCTGCGATGTTTGCCAAGTCTGGTGTGCTTTTAACTTTGCGACTAAGGAAGATGGCGTTCGAGGCTATGCTAAAACAGGATATGTCGTACTTTGATGATCCACTTCACAGTACTGGAGCATTAACTACAGCACTGGGAACACACGCTTCAGCTGTTCAAGGGGCCACAGGCACTCGTCTTGGTATTGTTCTGACATCTATAAGTACAGCTGTTGCCTGCACCGTGTACGCTTTGTACAATGGCTGGAAGTTGTCTCTAGTAGTTTTTTCTTTTATACCATTTCTGATACTGGCTGGTGCTATTCAAATGAAAGTATTCACAGGACGTGGAATCTCCAACGATGGCGAAGATGAACTCGTTCAGTCCGGCAAGATTGCAGTTGAAACAATAGAAAATATCCGAACTGTGGCGTCCCTGGGCAGAGAAAACACTTTCTTTTGTGACTACGCTCGAGCTTTAACTAATCCATACAAAAAGGCTTTAAAAAAAGCTCACCTTCAAGGAGCGTCATTCGGCTTAGCGTCGGCATTCAAGTTCTGTGCTACTGCGGCAGCATTTAGATATAGTGGACATCTTGTGGTGAACGGAGAAATGACCATGGACGAAGTAATGAAGGTGGTTATGTCCATCATGATAGGTGGTGCGATGCTGGGCCATCTCAGCGCTTTCTCGTCAGACTATGAGAAGGCCAAGATCGCTGCTGCTCGCCTCTTTAAAATCTTTGACCGTAAATCTGCAATTGACAGTTCCTCTGAAGATGGTTTAACACCGAGTTCTGTAACAGGAACAATCCAGTTACGAAGCGTGCGTTTCCGTTATCCAACCCGACCAAACGTCAAGGTGTTACGAGGATTAACACTGTCTGTTCAGAAAGGACAGAAACTTGCTCTTGTTGGTTCAAGTGGTTGCGGTAAAAGTACAGTAGTTTCTCTTTTGGAGAGATTTTACGATATCGAGGACGGAGAAGTGGCCATCGATGGTAACAGTGTCCGAAGTCTGAACATACAGTGGCTACGCTCTCATATTGGTATCGTGTCACAGGAGCCTGTATTGTTTGGCTGTAGCATCGCTGATAACATCGCGTACGGTGATAACTCCCGTGAAGTAAGCAAGGATGAAATAGAAGCAGCAGCTAAAGCGGCTAATATACACAGCTTCATTAATTCTCTTCCCATGGGTTATGATACTCTGGTGGGAGACAAAGGAACTCTGATCTCAGGAGGACAGAAGCAAAGAATAGCCATTGCTAGAGCGTTGATCCGCAATCCACGAATCCTGCTTCTTGATGAGGCTACATCTGCTTTGGATACAGAGAGTGAAAAGGTTGTCCAGAAAGCATTGGACGCCGCAAGTGAGGGTCGCACAGCCATCATCATTGCACATCGATTGTCCACGGTACAGAACGCTGACATCATAGCGGTCATTCATCACGGGCGCGTGGCAGAGCAAGGCACACACCAAGAGCTGTTGAGTCTTAAAGGAATTTACTACAGTCTTGTTACGGCTCAAATGCAGACCGCAAATAATTAA

Transcript

OS493_015273-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P21448	ATP-dependent translocase ABCB1 OS=Cricetulus griseus OX=10029 GN=ABCB1 PE=1 SV=2
P08183	ATP-dependent translocase ABCB1 OS=Homo sapiens OX=9606 GN=ABCB1 PE=1 SV=3
P21447	ATP-dependent translocase ABCB1 OS=Mus musculus OX=10090 GN=Abcb1a PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000779 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00005 all species →	ABC_tran	ABC transporter	Domain	Interproscan
PF00664 all species →	ABC_membrane	ABC transporter transmembrane region	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003439 all species →	Domain	ABC transporter-like, ATP-binding domain	Interproscan
IPR039421 all species →	Family	Type 1 protein exporter	Interproscan
IPR017871 all species →	Conserved_site	ABC transporter-like, conserved site	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR011527 all species →	Domain	ABC transporter type 1, transmembrane domain	Interproscan
IPR036640 all species →	Homologous_superfamily	ABC transporter type 1, transmembrane domain superfamily	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24222 all species →	ABC TRANSPORTER B FAMILY	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0042626 all species →	Molecular Function	ATPase-coupled transmembrane transporter activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0140359 all species →	Molecular Function	ABC-type transporter activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05658	ABCB1, CD243; ATP-binding cassette, subfamily B (MDR/TAP), member 1	EC:7.6.2.2	CD molecules	ko04090	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015273-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

125.0Max TPM

23.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.80	7.76
polyp at pH7 6	18	18	12.40	28.00
coral polyp · control treatment	16	16	24.04	102.55
coral polyp · oil and dispersant treatment	16	16	62.26	116.52
coral polyp · oil treatment	16	16	11.08	20.58
coral polyp · dispersant treatment	16	16	44.65	125.04
Polyp	10	9	1.75	5.15

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.76
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.46
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.36
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.19
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.66
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.33
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.50
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.32
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.23
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.90
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.30
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.58
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.58
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.09
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.11
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.11
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.05
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.86
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.14
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.52
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.02
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.96
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.54
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.71
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.12
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.33
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.06
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.04
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.99
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.69
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.27
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.04
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.76
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.13
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.80
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	102.55
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.59
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.29
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.84
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.62
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.61
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.87
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.57
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.27
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.25
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.90
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.09
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.18
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.19
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.96
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.90
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	116.52
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	112.74
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	96.66
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.92
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.47
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	70.24
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	64.57
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	61.06
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	60.07
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	60.05
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.83
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.76
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.61
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.10
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.68
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.87
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.58
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.51
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.30
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.30
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.10
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.43
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.04
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.93
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.34
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.27
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.28
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.16
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.99
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.36
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.14
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.60
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	125.04
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	104.84
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	83.27
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	69.63
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	66.28
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	62.03
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.98
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.17
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.74
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.46
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.62
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.39
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.34
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.33
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.22
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.08
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.15
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.75
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.63
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.70
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.56
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.05
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.81
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.51
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.38
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.