Gene detail

Detailed information of OS493_015362-T1 in Lophelia pertusa

Genomic Location: scaffold_46:333872...392075
NR annotation: KAJ7372908.1, Dedicator of cytokinesis protein 6 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015362-T1

ATGGCTGCTCAGAGCAGTCAAGGTTCTACTGGCTCAACAAGAGCGTTTGCACAAAAACTTAACAAGTTTCGACGAAATGGTTCGACGGCAACATTTGGCACTCAGACAAGTTTTACCAAGTCGGAGTCTTCTTCCAGTTCCTTTCTTCATTTTGCGGCTGGAACGATTCCCCTTAATGAAGTTGTGGAACCTCCAGATTTTGAAGATATTGTATTGCAAAACCAACCTTTCAATGAGAATGATCCAAATAGTAAAATGTTGGAATTTCCTGATGATGACATAGAGGTCACTACAATTCCCAGACAATGCCGCACTGTCAAGCCATGCTTTCCCAAGGATACTGGAATTGATAACAACCCTCAGCTTAAAGACTGTATCCATTGTTACACTGCAGACTGGGCAATTGTCAATCGCAGATATCAGTTCCGTTGTTCTGATGAAGGGAAACCAGACTCAAGGCGTAAAGTAGCACGGACGTCCAGCTTTGTGGGAACACTTCCCAACCAGGTTTATGAAATAGATGAAAAAGGAAAACTGCTAGACCAGGGGAAGAATGGAATGCAAGAGAAGACATCTCAACAATTAGGAAAAGGACAGGAAGAGTTACCCAGGGGCAGCTGGGCATCCAGCATATTTGACTTGCAGTCATGTAATCCTGACCCACTACTCCCATCTCTTCTTGATCGGACTCCCCCCGATGAGCTGGACACTGCAAATGAGGAAGATCGCTATCTTCACAGGATACATTCTTTATTTTCCATTTATCCTATTCAGCAGGAAGAAGGAATAGAAAAGAGGGTTCCTGCTACCATTCCTCAAGAGCATTTTGGGCTGAGAATTCTGGTCAAATGTCTTCTACTGAAGCTTGAGTTAGAAGTGGAACCAATATTTGCATCAATGGCTCTTTATGATGGCAGAGTGAAGAAAAAGATATCAGAAAATTGTTACTTTGACATGAACAGTGAATGGTGCAGGAAGTTGGTGAAAGAACACAATCCTCGCACAGATATTTCCACTCTAAGTCGCTCAGCAGTGTTTTCTATCACATACCCCTCAACAGATGTGTTTCTTGTCATAAAGTTGGAAAAAGTTCTCCAACAAGGTGATATTAGTGAATGTGCAGAACCATACTTGAAGGATACAGAAAACTCTAAGCATCGAGACAAGATGCGTTCGGCTGCTGTATCAAACTGTGACAGGCTTGGCAAGTATCGCATGCCATTTGCATGGACTGCAATCCATCTTGTTGACGTTTTAAGTGGGAAACCAGCAAGCACTGATGCACCAGCGGCAGCAGCGCCAACAGCAACAGGTCCTTCACAACAGGAGAAAGACACTCCTCCAGCTGGCACTCCAGCTAGGAAGCAATCTGGTATTGTAGAAACACCCCCTGTGGTGCCAAGAAGTACCAAGCGCAAGGACAGTGAAACTGCCTCTAGCCGCATGTCAGTGATTGAGGCACGCAAGTCAGTTCATCTGGGGGATGGCAGTGAATTTGAAGTAGTCCCTGACCTGACAAACTTTACACCTGTCACACTTACAGTCAGTAGTTTTTTCAAACAGGAATCTGATAAGTTGAAAGATGATGACTTGTACAAATTCTTAGCTGACCTGAAAAGACCTTCTTCAATATTGAAACGTCTTAAATGCATTCCAGGAAAACTGAAGCTTGACATTTCTCCTCCAGGAGACAAACCACCATACTGCTTAACTTCTGAGTTGCACCAGGTACACCCTTATCCAGACAGACAGGGCCGACCAACTAAAGAGATTGAAGAGTTTGCACCCAAAGAAGTGTTTTCCCCTTATCTTACATACAAGAACCTGTTTTATGTGTACCCCTTGAGTGTTAATTATACCAGTAGAAGCACATCTGCCAGAAACATTGCAGTCAAATGGATCCCAGCTATAAAGGATGGCCGGCTTTCTCTTGGTGAATTTCATCTTCCAGTATCTTTGGAGAAGCCACCCTCCAGTTACAGTATGCCTTTCACCAGAGGTGCAACTTCCTGGTATGAAATGGGTGGAGGGTCACAAGGGTTTTCCATGTTGCTGTCAGGACTGTATCTTCAATTTACACTCAGGATATACCGATTCATAAATTTTTAA

Transcript

OS493_015362-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q96N67	Dedicator of cytokinesis protein 7 OS=Homo sapiens OX=9606 GN=DOCK7 PE=1 SV=4
Q8R1A4	Dedicator of cytokinesis protein 7 OS=Mus musculus OX=10090 GN=Dock7 PE=1 SV=3
Q96HP0	Dedicator of cytokinesis protein 6 OS=Homo sapiens OX=9606 GN=DOCK6 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000675 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF11878 all species →	DOCK_C-D_N	Dedicator of cytokinesis C/D, N terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR021816 all species →	Domain	Dedicator of cytokinesis C/D, N-terminal	Interproscan
IPR026791 all species →	Family	Dedicator of cytokinesis	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23317 all species →	DEDICATOR OF CYTOKINESIS DOCK	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005085 all species →	Molecular Function	guanyl-nucleotide exchange factor activity	Interproscan
GO:0007264 all species →	Biological Process	small GTPase-mediated signal transduction	Interproscan
GO:0043547 all species →	Biological Process	positive regulation of GTPase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_015362-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015362-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

21.5Max TPM

10.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.88	21.07
polyp at pH7 6	18	18	9.38	21.15
coral polyp · control treatment	16	16	12.39	21.54
coral polyp · oil and dispersant treatment	16	16	10.96	16.03
coral polyp · oil treatment	16	16	9.86	15.94
coral polyp · dispersant treatment	16	16	14.05	21.39
Polyp	10	10	3.60	8.10

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.07
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.22
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.39
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.13
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.20
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.04
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.90
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.49
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.14
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.03
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.89
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.31
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.29
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.65
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.54
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.51
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.08
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.91
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.15
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.59
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.61
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.36
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.53
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.01
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.84
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.46
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.64
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.03
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.62
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.37
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.57
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.25
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.01
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.79
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.90
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.10
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.54
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.01
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.88
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.86
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.98
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.82
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.57
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.37
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.43
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.42
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.36
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.27
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.63
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.74
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.36
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.94
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.03
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.12
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.11
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.18
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.51
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.07
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.97
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.94
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.85
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.04
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.29
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.71
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.92
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.18
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.38
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.08
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.94
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.37
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.97
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.85
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.27
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.78
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.62
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.34
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.98
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.73
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.85
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.50
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.26
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.98
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.19
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.17
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.39
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.20
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.39
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.46
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.45
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.45
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.68
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.12
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.65
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.26
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.23
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.79
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.13
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.36
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.39
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.81
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.10
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.22
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.13
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.80
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.55
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.36
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.50
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.93
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.93
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.44

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.