Gene detail

Detailed information of OS493_015482-T1 in Lophelia pertusa

Genomic Location: scaffold_46:2328037...2337288
NR annotation: KAJ7373012.1, hypothetical protein OS493_015482 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015482-T1

ATGGAGATAGACGAGCATGCGAGCGAAAGATGTCGTTGGGTTCGAATCAACTGGAAATGGGGGACAATTGGAGGGCGAAAACTTGGCATTTTCCTGCGATTCAACCCGGTGGTGACGTTTTTGTCCGCCGCTATCATCTGGTTCTTCGTGATTTGGTGCGCGGTCCAAGCCGATGTCGCTAACAAGGAGATGGCGAAATGGATGGTGTGGATTACGGAGACTTTCACCTGGATGTACATCGGTACCCAAGATGTGTGGGCAATTTTCATTATTGTGCTCTACTTCTCCAAGTATGGAAAAATGAAACTTGGAAAACCCGATGACGAGCCGGAATTCAATGACCTGACGTACTTCACAATGTTATTCGCTGCTGGCATCGGGATTGGTTTGTTCTACTTCGGAGTGGCTGAACCTGTCTGGCATTATGCGCCTGGAACATATGGAAACCGGTATTGGGACAGGTACAGCGACAATCAGCGAGCACAGGATGCTATCAATTTGACGTTGTTCCACTGGGGTATCCATGGATGGATCGTGTATGTGGTAGTTGGTCTCCTTCTCGCCTTCGTGGGTTACAGAAAAGGCCTTCCCATGACCATACGCTCATGTTTCTATCCTCTCATTGGGGACAAGATCTACGGCTGGATGGGTGATGCGGTAGACATCTTATCTGTGGTGTGCACCATGTTTGGCGTTTGTACCAGTCTTGGTGTTGGTGTCATGCAGATGAACAATGGCTTCAAACGTCTGAACCCAGCTATCGAGTTCAACGTCACCAACCAAATCATCATCATTTGGTCAGTGACAGCGTGTGCCACGGCTTCTGTAGTTAGCGGCTTAAAGAGTATTGGATACTACTTGCAGTGGATTGTACAACTTGGCTTTCACACAGATGCCTTCGCACAACTGGGAAATGCACCCGATGGAAAGCAGGCTCAGCGATGGATGAATGACTGGACCATCTTCTACTGGGGATGGTGGATCGCCTGGTCTCCGTTCGTGGGCATGTTCATTGCGAAGATTTCCAAGGGACGAACCATCCGACAGTTCATCAATGGCACAATGACAGCGCCGATATTGTACGCGTTCTTGTGGTTTTGCATTTTTGGTAGTGCAGGCTTGAAGATGGAGCGTGATGCTGCCCTTGCCAACATAACGTGTGACTCTAAGCTGGGTGGAACTGGATCAGCGTCTTCATTAAATGGCCTGTACCGCTTGTCCTGCCGAGGAAAGAACGACATGTGGTTCGATGTGATGGAACAGTACGGTGACCTAGGAACGTTTCTCCAAGTCATTTCACTCATCAGCGTTATTCTCTATTTCGTCACCAGTTCTGATAGTGGTTCTCTTGTGATCGATTGCCTCTCAGCCAATGGCGATCCAGAACCTCCTGTCATACAACGTATCTTCTGGGCCCTGACAGAAGGCGCAACAGCTACAGCTCTGCTAAATGCTGGAGGCACAGAGGGGCTTGTGGCTTTGCAGTCCATGTCAATAGCATCCGGTGTCCCTTACACTATATTGCTGTGCTTTATGTGTGTGGCATTATGGCGAGCTGTGAAGATGGAAGGTGGTGATCTTGATCCGCATGGTCCGCAGTTCACCACCAGTCTCTTGGACGTCCTAAGCAGTCCAACCGAATCAAGCGTCGGCAAGGTTCTGCTAGCTGTCATTGCACCGTGGTACTCAATGGGAAATGCTGCCTACAAGATTGGTGGTAAAAAAGAACCTCGGTGGATGTACATGACGCTCCTGGCAGTTCTATTTTACACGTGGCTTATCCTGATGGCTTTGGAACCTGTTGTGAGTGCAATATCCTACGTTGCCTGGTCGATTCTGATCGGGTTTTTTGCCTACGCTACATCCATTCGTTATTCCATTCGCGAGAAGTACAACATCTATGGCAACAGCGTGGAGGATTTCTTTGCAGTGATGATCTTGTACCCATTCGCAGCCTACCAGATGGATCACCACATGGATCACGTCTATGATTTGGATCAACCAGATTACCACATGGATCATGTGAACAACATGGCGAAACCAAACGACACGGCATACCGCACCGGTCATGGGCCTGAGGTGGAATACCCAGCCAACCGTCAGGACTACCACAACGATGACGCCTATCAGTTGGAAAAAGAACCCCGCCCAGAAAATGGTAATTGGACACCGACAATTTCCATGCATGATCTCTCTTATCCAGGGTCTCATTTTAACCCTGCGATAAATGACAGAGGGAAGCCTGGAGATTCCTACTGGTCCAAGACTGAAGTCATTTAA

Transcript

OS493_015482-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q87NG3	Glycine betaine transporter 1 OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) OX=223926 GN=VP1905 PE=1 SV=1
Q87PP5	Glycine betaine/proline/choline/ectoine transporter VP1456 OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) OX=223926 GN=VP1456 PE=1 SV=1
P9WPR6	Uncharacterized transporter MT0942 OS=Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) OX=83331 GN=MT0942 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000591 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04749 all species →	PLAC8	PLAC8 family	Family	Interproscan
PF02028 all species →	BCCT	BCCT, betaine/carnitine/choline family transporter	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006461 all species →	Family	PLAC8 motif-containing protein	Interproscan
IPR000060 all species →	Family	BCCT transporter family	Interproscan
IPR018093 all species →	Conserved_site	BCCT transporter, conserved site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30047 all species →	HIGH-AFFINITY CHOLINE TRANSPORT PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006810 all species →	Biological Process	transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0016021 all species →	Cellular Component	membrane	Interproscan
GO:0022857 all species →	Molecular Function	transmembrane transporter activity	Interproscan
GO:0071705 all species →	Biological Process	nitrogen compound transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_015482-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015482-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

366.7Max TPM

43.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.54	24.85
polyp at pH7 6	18	18	23.73	107.59
coral polyp · control treatment	16	16	40.46	106.48
coral polyp · oil and dispersant treatment	16	16	114.84	366.71
coral polyp · oil treatment	16	16	31.45	100.87
coral polyp · dispersant treatment	16	16	69.51	289.81
Polyp	10	10	10.58	39.23

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.85
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.32
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.00
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.68
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.83
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.40
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.96
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.77
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.13
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.05
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.75
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.48
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.08
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.04
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.69
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.26
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.20
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	107.59
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	102.31
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.06
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.05
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.57
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.95
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.63
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.36
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.60
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.57
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.40
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.17
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.49
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.27
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.70
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.82
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.98
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.61
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	106.48
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	82.18
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	79.90
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.43
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.67
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.86
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.53
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.65
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.28
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.25
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.90
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.90
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.33
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.61
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.65
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.70
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	366.71
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	356.68
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	282.92
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	163.30
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	150.01
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	76.56
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.23
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.43
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.18
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.58
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.77
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.79
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.41
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.58
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.44
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.88
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	100.87
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	85.32
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.20
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.87
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.49
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.91
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.39
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.49
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.87
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.57
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.14
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.24
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.06
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.67
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.69
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.49
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	289.81
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	283.72
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	101.12
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	94.22
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	78.57
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	73.16
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.33
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.24
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.11
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.81
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.19
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.53
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.05
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.70
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.00
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.62
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	39.23
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	21.77
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.95
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.84
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.38
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.35
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.74
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.49
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.37
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.64

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.